ID: 1094404456

View in Genome Browser
Species Human (GRCh38)
Location 12:30100453-30100475
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094404456_1094404459 -2 Left 1094404456 12:30100453-30100475 CCTGTGCAGTCTACAGCCAGCCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094404456 Original CRISPR AGGCTGGCTGTAGACTGCAC AGG (reversed) Intergenic
No off target data available for this crispr