ID: 1094404459

View in Genome Browser
Species Human (GRCh38)
Location 12:30100474-30100496
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094404453_1094404459 12 Left 1094404453 12:30100439-30100461 CCTCCAAAAGTTTCCCTGTGCAG No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data
1094404454_1094404459 9 Left 1094404454 12:30100442-30100464 CCAAAAGTTTCCCTGTGCAGTCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data
1094404452_1094404459 18 Left 1094404452 12:30100433-30100455 CCATCACCTCCAAAAGTTTCCCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data
1094404456_1094404459 -2 Left 1094404456 12:30100453-30100475 CCTGTGCAGTCTACAGCCAGCCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data
1094404455_1094404459 -1 Left 1094404455 12:30100452-30100474 CCCTGTGCAGTCTACAGCCAGCC No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094404459 Original CRISPR CTCAATCCCATCCCTAACCC TGG Intergenic