ID: 1094406985

View in Genome Browser
Species Human (GRCh38)
Location 12:30126736-30126758
Sequence TCCAGGAAATGAAACACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094406985_1094406993 24 Left 1094406985 12:30126736-30126758 CCTGCCGTGTTTCATTTCCTGGA No data
Right 1094406993 12:30126783-30126805 ATGTTCAAAGTTATTCTTTTGGG No data
1094406985_1094406994 25 Left 1094406985 12:30126736-30126758 CCTGCCGTGTTTCATTTCCTGGA No data
Right 1094406994 12:30126784-30126806 TGTTCAAAGTTATTCTTTTGGGG No data
1094406985_1094406992 23 Left 1094406985 12:30126736-30126758 CCTGCCGTGTTTCATTTCCTGGA No data
Right 1094406992 12:30126782-30126804 AATGTTCAAAGTTATTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094406985 Original CRISPR TCCAGGAAATGAAACACGGC AGG (reversed) Intergenic
No off target data available for this crispr