ID: 1094411586

View in Genome Browser
Species Human (GRCh38)
Location 12:30172694-30172716
Sequence CTGTCCACACACATGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094411586_1094411592 29 Left 1094411586 12:30172694-30172716 CCTGGGGGCATGTGTGTGGACAG No data
Right 1094411592 12:30172746-30172768 AAGACACCATGTAAAGTGTCTGG No data
1094411586_1094411587 -3 Left 1094411586 12:30172694-30172716 CCTGGGGGCATGTGTGTGGACAG No data
Right 1094411587 12:30172714-30172736 CAGAACCCTATGTTAAGTGTCGG No data
1094411586_1094411588 0 Left 1094411586 12:30172694-30172716 CCTGGGGGCATGTGTGTGGACAG No data
Right 1094411588 12:30172717-30172739 AACCCTATGTTAAGTGTCGGTGG No data
1094411586_1094411591 4 Left 1094411586 12:30172694-30172716 CCTGGGGGCATGTGTGTGGACAG No data
Right 1094411591 12:30172721-30172743 CTATGTTAAGTGTCGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094411586 Original CRISPR CTGTCCACACACATGCCCCC AGG (reversed) Intergenic
No off target data available for this crispr