ID: 1094412650

View in Genome Browser
Species Human (GRCh38)
Location 12:30183235-30183257
Sequence GAAGCCTGGATGAGTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094412650_1094412654 13 Left 1094412650 12:30183235-30183257 CCAGAAGCACTCATCCAGGCTTC No data
Right 1094412654 12:30183271-30183293 TTGCATGTGCCCCTGCCACAGGG No data
1094412650_1094412655 14 Left 1094412650 12:30183235-30183257 CCAGAAGCACTCATCCAGGCTTC No data
Right 1094412655 12:30183272-30183294 TGCATGTGCCCCTGCCACAGGGG No data
1094412650_1094412653 12 Left 1094412650 12:30183235-30183257 CCAGAAGCACTCATCCAGGCTTC No data
Right 1094412653 12:30183270-30183292 CTTGCATGTGCCCCTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094412650 Original CRISPR GAAGCCTGGATGAGTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr