ID: 1094414178

View in Genome Browser
Species Human (GRCh38)
Location 12:30200976-30200998
Sequence AAGAGCACGGAGCCGGCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094414178 Original CRISPR AAGAGCACGGAGCCGGCGAC TGG Intergenic
900463905 1:2814699-2814721 CACAGCACCGAGCCGGGGACAGG + Intergenic
900477567 1:2883058-2883080 ACGCGCTCGGAGCCGGCGCCCGG - Intergenic
905899229 1:41570142-41570164 AAGAGCACGGAGCCTGGGGCTGG + Intronic
906725638 1:48042149-48042171 AAGATCACGGAGCTGGTGAGTGG - Intergenic
907430002 1:54406169-54406191 AAGAGCGCGGAGCCAGCGCCTGG - Exonic
908230522 1:62100339-62100361 AAGAGCATGGAGCCAGCATCTGG + Intronic
923800949 1:237207622-237207644 AAGATCAAGGAGCCGGCATCCGG - Intronic
1063395662 10:5685029-5685051 GGGAGCGCGGAGCCGGCGACTGG + Exonic
1065731492 10:28713474-28713496 AAGATCACAGAGCTGGGGACTGG - Intergenic
1066043554 10:31577411-31577433 AAGAGCATGGTGCCGGCATCTGG - Intergenic
1076189127 10:128470443-128470465 AAGAGCAGGCAGCCTGCCACGGG + Intergenic
1076478817 10:130770378-130770400 AAGAGCCCAGGGCAGGCGACAGG - Intergenic
1081492562 11:43579520-43579542 AGGAGCAGGGAGTCGGCGCCCGG + Intronic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1093939846 12:25041105-25041127 CAGAGCAAGGAGCCGGTGCCAGG + Intronic
1094118125 12:26938839-26938861 AGGAGCAGGGAGCCCGCGGCGGG - Intronic
1094375612 12:29784419-29784441 GAGAGCACAGAGCCGGCGACTGG - Intronic
1094411297 12:30170565-30170587 AAGATCACGAAGCTGGCGACTGG - Intergenic
1094414178 12:30200976-30200998 AAGAGCACGGAGCCGGCGACTGG + Intergenic
1096809816 12:54162085-54162107 AAGAGAAGGGAGCAGGGGACAGG + Intergenic
1113473268 13:110561717-110561739 CAGAGCACGGAGCCCACGTCGGG + Exonic
1114037882 14:18646370-18646392 AAGAGCGCGGAGCCAGCGCCTGG - Intergenic
1114120739 14:19668658-19668680 AAGAGCGCGGAGCCAGCGCCTGG + Intergenic
1124248816 15:28094652-28094674 AAGAGCGCAGAGCCGGAGAGAGG - Intronic
1125729039 15:41882538-41882560 AAGGGCAAGGCGCTGGCGACCGG + Intronic
1134041324 16:11070723-11070745 AAGAGCAAGGAGGCAGAGACAGG - Intronic
1140260499 16:73374126-73374148 AAAATGAGGGAGCCGGCGACAGG + Intergenic
1144937045 17:18908203-18908225 GAGGCCACGGAGCCAGCGACGGG + Intronic
1146283569 17:31559932-31559954 CGGTGCACAGAGCCGGCGACCGG + Intergenic
1151177609 17:72301695-72301717 AAGAGTATGGAGCCAGAGACTGG - Intergenic
1156278627 18:35610258-35610280 AAGAGCAGGGAGCCAGACACAGG - Intronic
1161307174 19:3574452-3574474 AAGCGCACGTAGCCCGTGACCGG - Exonic
1163479776 19:17548248-17548270 AAGGGCACGGAGCGGGAGGCTGG + Intronic
1165470034 19:35997898-35997920 AAGAGCACGGACCCGGGAATGGG + Intergenic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167628396 19:50607512-50607534 AAGAGGATGGGGACGGCGACAGG - Intergenic
927645357 2:24873767-24873789 AAGGGCATGGAGCTGGCGCCAGG - Intronic
930387219 2:50711917-50711939 AAGATCAAGGTGCCGGCGTCTGG - Intronic
931165348 2:59741277-59741299 AACAGCAGGGAGCAGGCTACAGG - Intergenic
933480292 2:82848397-82848419 AAGAGCATGGTGCTGGCAACTGG + Intergenic
936445620 2:112592384-112592406 AAGAGCACGGTGCCTGCATCTGG - Intergenic
936507096 2:113116514-113116536 AGGGGCAGGGAGCCGGCCACAGG - Intronic
942523889 2:176832496-176832518 AAGAGCACAGAGCAGGCCAGTGG - Intergenic
948512195 2:238476088-238476110 AAGATCACAGAGCTGGGGACAGG - Intergenic
1168961489 20:1873011-1873033 AAGAGCATGGAGCTGGCATCTGG - Intergenic
1169121670 20:3100326-3100348 AAGAGAACGGAGCCTGGGAGTGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175859817 20:62144017-62144039 AAGGGCACGGGGCCGCCGTCGGG - Intronic
1176293271 21:5057456-5057478 AGGAGGACGGAGTCGGAGACTGG - Intergenic
1178843683 21:36157148-36157170 GAGAGCTCGGGGCCGGAGACCGG + Intronic
1179019685 21:37627224-37627246 AAGAGCACAGAGCTGGCGTGAGG - Intronic
1179863989 21:44206194-44206216 AGGAGGACGGAGTCGGAGACTGG + Intergenic
1180462009 22:15573412-15573434 AAGAGCGCGGAGCCAGCGCCTGG - Intergenic
1181175294 22:21031827-21031849 AAGAGCACCGAGCCAGCTACTGG + Exonic
1182549588 22:31093633-31093655 AGCAGCACTGAGCCGGCGGCTGG + Intronic
1185321248 22:50201108-50201130 TAGAGCGGGGCGCCGGCGACGGG - Exonic
956867454 3:73384031-73384053 AAGAGCGGAGAGCCAGCGACGGG - Exonic
962283469 3:134068833-134068855 AAGAGCACAGAGCTGGCTCCAGG + Intronic
969436569 4:7192525-7192547 CAGAGAAAGGAGCCGGCGAGGGG - Exonic
969715829 4:8867724-8867746 AAGGGCACGGAGGCGGCGGCCGG + Exonic
970678571 4:18481032-18481054 AAGAGCCAGGAGCAGGTGACAGG + Intergenic
980812808 4:137904679-137904701 AAGAGCACGGAGTCTGGGGCTGG + Intergenic
985569274 5:635699-635721 AAGAGCACGGTGCCGGCACCTGG + Intronic
1000840640 5:166213622-166213644 AAGAGCATGAAGCCAGCAACTGG + Intergenic
1003603735 6:7541727-7541749 GCGAGCGCGGAGACGGCGACGGG - Exonic
1008768378 6:54948074-54948096 AAGAGCATGGAGCAGGTGAAAGG + Intergenic
1011219653 6:85040830-85040852 AAGAGCACGAAGCTGGAGTCTGG - Intergenic
1012694273 6:102357300-102357322 AGGAGTAGGGAGCCGTCGACAGG + Intergenic
1023405847 7:39833397-39833419 AAGAGCGCGGAGCCAGCGCCTGG + Intergenic
1035479576 7:159171274-159171296 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035479622 7:159171493-159171515 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035479651 7:159171639-159171661 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035479668 7:159171712-159171734 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035479714 7:159171931-159171953 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035479743 7:159172077-159172099 AAGGGCACTGGGCCGGCGTCTGG + Intergenic
1035605422 8:927019-927041 AAGAGCTCAGAGCCGGGGACTGG + Intergenic
1037772003 8:21807363-21807385 AAGAGCATGGTGCTGGCGTCTGG - Intronic
1049557575 8:143290865-143290887 AAGAGCCCAGAGCCCGCGAGAGG + Intronic
1049599514 8:143500609-143500631 AAGAGCATGGTGCCGGCACCAGG + Intronic
1050090993 9:2016414-2016436 AAGAACACGGACCCGGGGAGAGG - Intronic
1051469986 9:17427207-17427229 CAGAGCACGGAGCATGTGACTGG - Intronic
1051894625 9:21974811-21974833 AGCAGCATGGAGCCGGCGGCGGG - Exonic
1053504167 9:38627073-38627095 AAGAGCAAAGAGCCGGAGAGGGG + Intergenic
1053690294 9:40583685-40583707 AGGGGCACGGCGCCGGCGCCAGG - Intergenic
1054301545 9:63384646-63384668 AGGGGCACGGCGCCGGCGCCAGG - Intergenic
1057152208 9:92806521-92806543 AAGAGCAAAGAGCCGGAGAGGGG - Intergenic
1058467614 9:105244835-105244857 AGGAGCCCGGAGGCGGCGCCGGG - Exonic
1061577662 9:131517616-131517638 CAGAGCACAGAGACGGCGAGTGG - Intronic
1192236474 X:69299447-69299469 AAGAGCACAGAGTAGGCGACTGG - Intergenic
1195805658 X:108762700-108762722 AAGATCAAGGAGCCGGCATCTGG + Intergenic
1196072287 X:111539228-111539250 AAGAGCACGCTGACGGGGACCGG + Intergenic
1197862471 X:130985106-130985128 AGGAGCATGGAGCAGGTGACAGG - Intergenic