ID: 1094421250

View in Genome Browser
Species Human (GRCh38)
Location 12:30273439-30273461
Sequence CAAAATGCTGATAGTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094421250_1094421254 4 Left 1094421250 12:30273439-30273461 CCCATATTACTATCAGCATTTTG No data
Right 1094421254 12:30273466-30273488 AAATCATTCGACATGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094421250 Original CRISPR CAAAATGCTGATAGTAATAT GGG (reversed) Intergenic
No off target data available for this crispr