ID: 1094427185

View in Genome Browser
Species Human (GRCh38)
Location 12:30327964-30327986
Sequence TTGGATCCACAGCTGCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094427185_1094427192 19 Left 1094427185 12:30327964-30327986 CCAAATTGCAGCTGTGGATCCAA No data
Right 1094427192 12:30328006-30328028 GGGTGTGCCCAGGAGCAGGCAGG No data
1094427185_1094427188 -2 Left 1094427185 12:30327964-30327986 CCAAATTGCAGCTGTGGATCCAA No data
Right 1094427188 12:30327985-30328007 AATTGTTGGTGTGCTCTTGTTGG No data
1094427185_1094427190 9 Left 1094427185 12:30327964-30327986 CCAAATTGCAGCTGTGGATCCAA No data
Right 1094427190 12:30327996-30328018 TGCTCTTGTTGGGTGTGCCCAGG No data
1094427185_1094427191 15 Left 1094427185 12:30327964-30327986 CCAAATTGCAGCTGTGGATCCAA No data
Right 1094427191 12:30328002-30328024 TGTTGGGTGTGCCCAGGAGCAGG No data
1094427185_1094427189 -1 Left 1094427185 12:30327964-30327986 CCAAATTGCAGCTGTGGATCCAA No data
Right 1094427189 12:30327986-30328008 ATTGTTGGTGTGCTCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094427185 Original CRISPR TTGGATCCACAGCTGCAATT TGG (reversed) Intergenic
No off target data available for this crispr