ID: 1094427586

View in Genome Browser
Species Human (GRCh38)
Location 12:30331385-30331407
Sequence CTTTCAGACTGAGCTACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094427585_1094427586 -8 Left 1094427585 12:30331370-30331392 CCACAATCTAAAAGGCTTTCAGA No data
Right 1094427586 12:30331385-30331407 CTTTCAGACTGAGCTACTCTAGG No data
1094427583_1094427586 28 Left 1094427583 12:30331334-30331356 CCTTTCTAGGGAAAAATGTTCTT No data
Right 1094427586 12:30331385-30331407 CTTTCAGACTGAGCTACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094427586 Original CRISPR CTTTCAGACTGAGCTACTCT AGG Intergenic