ID: 1094431335

View in Genome Browser
Species Human (GRCh38)
Location 12:30373116-30373138
Sequence GGGGACTCCTTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094431335_1094431343 0 Left 1094431335 12:30373116-30373138 CCTGTTTTTCCCAAGGAGTCCCC No data
Right 1094431343 12:30373139-30373161 GGCTACCAGAAGTTATCTTAGGG 0: 19
1: 42
2: 28
3: 54
4: 121
1094431335_1094431342 -1 Left 1094431335 12:30373116-30373138 CCTGTTTTTCCCAAGGAGTCCCC No data
Right 1094431342 12:30373138-30373160 CGGCTACCAGAAGTTATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094431335 Original CRISPR GGGGACTCCTTGGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr