ID: 1094432827

View in Genome Browser
Species Human (GRCh38)
Location 12:30388739-30388761
Sequence CAGGAAGCTTACAATTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094432826_1094432827 -8 Left 1094432826 12:30388724-30388746 CCTCTGGGGAGGCTTCAGGAAGC No data
Right 1094432827 12:30388739-30388761 CAGGAAGCTTACAATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094432827 Original CRISPR CAGGAAGCTTACAATTATGA TGG Intergenic
No off target data available for this crispr