ID: 1094436302

View in Genome Browser
Species Human (GRCh38)
Location 12:30424313-30424335
Sequence TCCAGATTCCAATGAATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094436302_1094436304 -6 Left 1094436302 12:30424313-30424335 CCCAATATTCATTGGAATCTGGA No data
Right 1094436304 12:30424330-30424352 TCTGGAGTTTGCTGTTGAATAGG 0: 19
1: 24
2: 16
3: 36
4: 249
1094436302_1094436306 6 Left 1094436302 12:30424313-30424335 CCCAATATTCATTGGAATCTGGA No data
Right 1094436306 12:30424342-30424364 TGTTGAATAGGAAAGTAGGATGG No data
1094436302_1094436305 2 Left 1094436302 12:30424313-30424335 CCCAATATTCATTGGAATCTGGA No data
Right 1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094436302 Original CRISPR TCCAGATTCCAATGAATATT GGG (reversed) Intergenic
No off target data available for this crispr