ID: 1094436305

View in Genome Browser
Species Human (GRCh38)
Location 12:30424338-30424360
Sequence TTGCTGTTGAATAGGAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094436303_1094436305 1 Left 1094436303 12:30424314-30424336 CCAATATTCATTGGAATCTGGAG No data
Right 1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG No data
1094436302_1094436305 2 Left 1094436302 12:30424313-30424335 CCCAATATTCATTGGAATCTGGA No data
Right 1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094436305 Original CRISPR TTGCTGTTGAATAGGAAAGT AGG Intergenic
No off target data available for this crispr