ID: 1094446171 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:30532966-30532988 |
| Sequence | CTGTCTACAAGGCTGATGCA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094446164_1094446171 | 7 | Left | 1094446164 | 12:30532936-30532958 | CCCCACTATGAAACACTGCCCCT | No data | ||
| Right | 1094446171 | 12:30532966-30532988 | CTGTCTACAAGGCTGATGCACGG | No data | ||||
| 1094446166_1094446171 | 5 | Left | 1094446166 | 12:30532938-30532960 | CCACTATGAAACACTGCCCCTCA | No data | ||
| Right | 1094446171 | 12:30532966-30532988 | CTGTCTACAAGGCTGATGCACGG | No data | ||||
| 1094446165_1094446171 | 6 | Left | 1094446165 | 12:30532937-30532959 | CCCACTATGAAACACTGCCCCTC | No data | ||
| Right | 1094446171 | 12:30532966-30532988 | CTGTCTACAAGGCTGATGCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094446171 | Original CRISPR | CTGTCTACAAGGCTGATGCA CGG | Intergenic | ||
| No off target data available for this crispr | |||||