ID: 1094446171

View in Genome Browser
Species Human (GRCh38)
Location 12:30532966-30532988
Sequence CTGTCTACAAGGCTGATGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094446164_1094446171 7 Left 1094446164 12:30532936-30532958 CCCCACTATGAAACACTGCCCCT No data
Right 1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG No data
1094446166_1094446171 5 Left 1094446166 12:30532938-30532960 CCACTATGAAACACTGCCCCTCA No data
Right 1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG No data
1094446165_1094446171 6 Left 1094446165 12:30532937-30532959 CCCACTATGAAACACTGCCCCTC No data
Right 1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094446171 Original CRISPR CTGTCTACAAGGCTGATGCA CGG Intergenic
No off target data available for this crispr