ID: 1094447307

View in Genome Browser
Species Human (GRCh38)
Location 12:30545911-30545933
Sequence CTGTGCTGGTAGAGGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094447300_1094447307 11 Left 1094447300 12:30545877-30545899 CCATCTATAGGTCTCTCAGCTAT No data
Right 1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG No data
1094447297_1094447307 25 Left 1094447297 12:30545863-30545885 CCCTGTGATGTGAACCATCTATA No data
Right 1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG No data
1094447298_1094447307 24 Left 1094447298 12:30545864-30545886 CCTGTGATGTGAACCATCTATAG 0: 5
1: 115
2: 196
3: 328
4: 421
Right 1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094447307 Original CRISPR CTGTGCTGGTAGAGGTGGCA GGG Intergenic
No off target data available for this crispr