ID: 1094450563

View in Genome Browser
Species Human (GRCh38)
Location 12:30579109-30579131
Sequence AAATGATGGCAAGAATATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094450558_1094450563 8 Left 1094450558 12:30579078-30579100 CCCATTACAATGGCTATCAAAAA No data
Right 1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG No data
1094450557_1094450563 15 Left 1094450557 12:30579071-30579093 CCTCACACCCATTACAATGGCTA 0: 3
1: 27
2: 173
3: 669
4: 1702
Right 1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG No data
1094450555_1094450563 18 Left 1094450555 12:30579068-30579090 CCACCTCACACCCATTACAATGG No data
Right 1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG No data
1094450559_1094450563 7 Left 1094450559 12:30579079-30579101 CCATTACAATGGCTATCAAAAAA No data
Right 1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094450563 Original CRISPR AAATGATGGCAAGAATATGG AGG Intergenic
No off target data available for this crispr