ID: 1094452835

View in Genome Browser
Species Human (GRCh38)
Location 12:30600785-30600807
Sequence TGCAAGGCTTAGGATAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094452835_1094452840 -8 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452840 12:30600800-30600822 GCCTTGCAGCCAACCTGGGGAGG No data
1094452835_1094452846 26 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452846 12:30600834-30600856 GCTATGAGAAAAAAGACACTGGG No data
1094452835_1094452842 -1 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452842 12:30600807-30600829 AGCCAACCTGGGGAGGAGCTTGG No data
1094452835_1094452845 25 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452845 12:30600833-30600855 TGCTATGAGAAAAAAGACACTGG No data
1094452835_1094452847 27 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094452835 Original CRISPR TGCAAGGCTTAGGATAAACA AGG (reversed) Intergenic
No off target data available for this crispr