ID: 1094452836

View in Genome Browser
Species Human (GRCh38)
Location 12:30600795-30600817
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094452836_1094452845 15 Left 1094452836 12:30600795-30600817 CCTAAGCCTTGCAGCCAACCTGG No data
Right 1094452845 12:30600833-30600855 TGCTATGAGAAAAAAGACACTGG No data
1094452836_1094452846 16 Left 1094452836 12:30600795-30600817 CCTAAGCCTTGCAGCCAACCTGG No data
Right 1094452846 12:30600834-30600856 GCTATGAGAAAAAAGACACTGGG No data
1094452836_1094452847 17 Left 1094452836 12:30600795-30600817 CCTAAGCCTTGCAGCCAACCTGG No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452836_1094452848 28 Left 1094452836 12:30600795-30600817 CCTAAGCCTTGCAGCCAACCTGG No data
Right 1094452848 12:30600846-30600868 AAGACACTGGGGAACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094452836 Original CRISPR CCAGGTTGGCTGCAAGGCTT AGG (reversed) Intergenic
No off target data available for this crispr