ID: 1094452841

View in Genome Browser
Species Human (GRCh38)
Location 12:30600801-30600823
Sequence TCCTCCCCAGGTTGGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094452841_1094452845 9 Left 1094452841 12:30600801-30600823 CCTTGCAGCCAACCTGGGGAGGA No data
Right 1094452845 12:30600833-30600855 TGCTATGAGAAAAAAGACACTGG No data
1094452841_1094452848 22 Left 1094452841 12:30600801-30600823 CCTTGCAGCCAACCTGGGGAGGA No data
Right 1094452848 12:30600846-30600868 AAGACACTGGGGAACACTACAGG No data
1094452841_1094452846 10 Left 1094452841 12:30600801-30600823 CCTTGCAGCCAACCTGGGGAGGA No data
Right 1094452846 12:30600834-30600856 GCTATGAGAAAAAAGACACTGGG No data
1094452841_1094452847 11 Left 1094452841 12:30600801-30600823 CCTTGCAGCCAACCTGGGGAGGA No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094452841 Original CRISPR TCCTCCCCAGGTTGGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr