ID: 1094452844

View in Genome Browser
Species Human (GRCh38)
Location 12:30600813-30600835
Sequence GCATCTCCAAGCTCCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094452844_1094452845 -3 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452845 12:30600833-30600855 TGCTATGAGAAAAAAGACACTGG No data
1094452844_1094452847 -1 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452844_1094452850 28 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452850 12:30600864-30600886 ACAGGCATTTTCCCAGACCTGGG No data
1094452844_1094452846 -2 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452846 12:30600834-30600856 GCTATGAGAAAAAAGACACTGGG No data
1094452844_1094452848 10 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452848 12:30600846-30600868 AAGACACTGGGGAACACTACAGG No data
1094452844_1094452849 27 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452849 12:30600863-30600885 TACAGGCATTTTCCCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094452844 Original CRISPR GCATCTCCAAGCTCCTCCCC AGG (reversed) Intergenic