ID: 1094452847

View in Genome Browser
Species Human (GRCh38)
Location 12:30600835-30600857
Sequence CTATGAGAAAAAAGACACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094452836_1094452847 17 Left 1094452836 12:30600795-30600817 CCTAAGCCTTGCAGCCAACCTGG No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452843_1094452847 3 Left 1094452843 12:30600809-30600831 CCAACCTGGGGAGGAGCTTGGAG No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452835_1094452847 27 Left 1094452835 12:30600785-30600807 CCTTGTTTATCCTAAGCCTTGCA No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452841_1094452847 11 Left 1094452841 12:30600801-30600823 CCTTGCAGCCAACCTGGGGAGGA No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data
1094452844_1094452847 -1 Left 1094452844 12:30600813-30600835 CCTGGGGAGGAGCTTGGAGATGC No data
Right 1094452847 12:30600835-30600857 CTATGAGAAAAAAGACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094452847 Original CRISPR CTATGAGAAAAAAGACACTG GGG Intergenic
No off target data available for this crispr