ID: 1094457262

View in Genome Browser
Species Human (GRCh38)
Location 12:30650439-30650461
Sequence ATGTAAATACAGTTGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 2, 1: 0, 2: 5, 3: 41, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094457262_1094457263 0 Left 1094457262 12:30650439-30650461 CCAAGAGTCAACTGTATTTACAT 0: 2
1: 0
2: 5
3: 41
4: 277
Right 1094457263 12:30650462-30650484 AAATTTAAAATGCTATCTCTAGG 0: 1
1: 1
2: 3
3: 57
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094457262 Original CRISPR ATGTAAATACAGTTGACTCT TGG (reversed) Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903355579 1:22745066-22745088 AGGTATATACAGCTGACCCTTGG - Intronic
904139989 1:28345407-28345429 ATGTATATAATGTTTACTCTAGG - Intergenic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
906408261 1:45559221-45559243 ATTTAAATACATTTTTCTCTTGG + Intronic
907422769 1:54358310-54358332 ATTTAGATACGGTGGACTCTTGG + Intronic
907538841 1:55193358-55193380 TTCTAAATACAGTTGTCCCTTGG - Intronic
907611628 1:55876904-55876926 ATGAAAATAAAGTTGACTCAAGG + Intergenic
907874738 1:58474551-58474573 AGGAACATACAGTTGACCCTTGG - Intronic
910190612 1:84591274-84591296 ATGTATATTCTGTTGTCTCTGGG - Intergenic
911453958 1:98099797-98099819 AGGTAAATACAGTTCAGGCTGGG + Intergenic
911522161 1:98942385-98942407 ATGTAAATATATTTGACACAGGG + Intronic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
912582360 1:110732148-110732170 TTATAAATACAGTCGTCTCTAGG - Intergenic
913136784 1:115898478-115898500 ATGTATGTACATTTGACTCTTGG + Intergenic
913391570 1:118319548-118319570 ATGTCAACACAGTTGACATTTGG - Intergenic
914330860 1:146670089-146670111 ATTTAAATGCAGATGACACTTGG + Intergenic
916948149 1:169750312-169750334 TTGTATATACAGTGGTCTCTGGG - Intronic
917004070 1:170392696-170392718 AAGTAACTACAGTTCTCTCTTGG + Intergenic
917087833 1:171321314-171321336 ATATATATACAGTTGTCTCTTGG + Intronic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
918026275 1:180751073-180751095 ATAGAAATACAGTTGAGTTTTGG + Intronic
918478859 1:184955630-184955652 ATGTAAGAAAAGTTGAGTCTGGG - Intronic
918783829 1:188737742-188737764 TTTAAAATACAGTTGACCCTTGG + Intergenic
919731956 1:200918717-200918739 TTGTAAAGACAATTGGCTCTGGG - Intergenic
921643885 1:217589584-217589606 ATTTAGGTACAGTTAACTCTTGG - Intronic
922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG + Intronic
923893074 1:238237156-238237178 ATATATACACAGTTGACCCTCGG - Intergenic
924853264 1:247852203-247852225 ATGCAAATACAGTTGGATCTGGG + Intergenic
1063142388 10:3267083-3267105 ATATAAATACTTTTCACTCTAGG + Intergenic
1063603472 10:7502472-7502494 AAGTAAATACATTTCATTCTGGG + Intergenic
1064874215 10:19975040-19975062 AAGTGAAAACAGTTGCCTCTGGG - Intronic
1065219562 10:23482497-23482519 ATGTAAAGACAATAGACACTGGG + Intergenic
1066311679 10:34203407-34203429 TTCCAAATACAGTTGTCTCTTGG + Intronic
1066318973 10:34280693-34280715 AAGTAAAGACCGTTGACTCCTGG - Intronic
1069010630 10:63367685-63367707 ATTTAAAAGCATTTGACTCTGGG - Intronic
1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG + Intronic
1070346641 10:75549419-75549441 ATTTAAATACAGTGGTCTGTTGG - Intronic
1070605347 10:77894437-77894459 ATGTTAATAGGGTTGCCTCTGGG + Intronic
1070686352 10:78485717-78485739 GTATAAATACAGTTGACCCTTGG - Intergenic
1073167686 10:101472023-101472045 ATGGAAATATGGTTGACTCCAGG - Intronic
1073715773 10:106105531-106105553 ATATACATTCAGTTGACTCAGGG + Intergenic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1078558152 11:12347765-12347787 ATGCAAATACAGTCACCTCTTGG + Intronic
1079879114 11:25901403-25901425 TAGTTAATACAGTTGACTCAAGG + Intergenic
1080999690 11:37653593-37653615 ATGAAAGTACAGATAACTCTTGG - Intergenic
1081088508 11:38831304-38831326 ATTTCTATACAGTTGACTCTAGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1087778548 11:102278934-102278956 TTGCAAATACAGTTGTCTCTTGG - Intergenic
1088096138 11:106103345-106103367 ATTTCAACACAGTTGACTGTAGG - Intergenic
1090093244 11:123718108-123718130 ATGTGAATACAATTGGCTTTAGG + Intergenic
1091646023 12:2273055-2273077 ATCTAAATACAGTTGTCCCTTGG + Intronic
1092855486 12:12669571-12669593 ATGTATATACAGTTGGCTCAGGG - Intronic
1093125234 12:15321400-15321422 CTGTACATACCGTTGACACTTGG + Intronic
1093304709 12:17500550-17500572 TTGAAAATACAGTTGTCCCTTGG + Intergenic
1093472478 12:19517635-19517657 AAATAAATACAGTTGTCTCTCGG - Intronic
1094407643 12:30135022-30135044 ATTTAAATACAGTTGACTGTTGG + Intergenic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1094593818 12:31845808-31845830 ATGTAAATACATTTGCTTCAGGG + Intergenic
1098268258 12:68745557-68745579 ATATATATACAGCTGTCTCTAGG - Exonic
1098690044 12:73475485-73475507 ATGAAATTATATTTGACTCTAGG - Intergenic
1099596757 12:84676299-84676321 ATGTTAATACATGTGACACTAGG + Intergenic
1099658060 12:85521130-85521152 ATCGAAATACAGTTTACTCTTGG - Intergenic
1099777841 12:87156208-87156230 ATCTAAATATACTTGACTTTTGG - Intergenic
1099913640 12:88864555-88864577 ATGAAAATACATTTGTCTCTTGG - Intergenic
1101390847 12:104298925-104298947 GTATAAATACAGTTGTCCCTCGG + Intronic
1102630600 12:114275278-114275300 ATGTTAACATAGTTGAGTCTGGG - Intergenic
1104681277 12:130753650-130753672 ATGAATATACAGTTGACCCATGG + Intergenic
1105537614 13:21283338-21283360 TTTTAAGTACAGTTGACCCTTGG + Intergenic
1105711797 13:23017144-23017166 CTGTGAATACATTTGACTCAAGG + Intergenic
1106947566 13:34845948-34845970 AAAGAACTACAGTTGACTCTTGG - Intergenic
1107137637 13:36961612-36961634 ATATATATACAGTTGTCTCTTGG - Intronic
1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG + Intergenic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1108584035 13:51852577-51852599 AGGAAAATACAGTTGACCCGCGG + Intergenic
1109249061 13:59996329-59996351 ATGTAAAGACACTTATCTCTAGG + Intronic
1109431029 13:62235330-62235352 ATTTCAACACAGTTCACTCTCGG + Intergenic
1109549003 13:63867817-63867839 ATGGGAATAAAGCTGACTCTTGG - Intergenic
1109870471 13:68326286-68326308 ATGTTAATTCAATTGACTTTTGG + Intergenic
1111365838 13:87243743-87243765 ACATATATACAGTTGTCTCTTGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1116490002 14:45494094-45494116 ATGTAAATACTGTTATTTCTTGG + Intergenic
1116761639 14:49022334-49022356 ATGAAAATGCAGTTGGCTCCAGG + Intergenic
1117660045 14:57994202-57994224 TTGCAATTACAGTTGTCTCTAGG - Intergenic
1117858491 14:60062359-60062381 ATGTAAATACACTGGACTTTGGG - Intronic
1118932132 14:70252674-70252696 ATGAAGATACAGTTGAGTGTGGG - Intergenic
1119641632 14:76319531-76319553 ATGTAATTACTATTTACTCTAGG + Intronic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1202903303 14_GL000194v1_random:55274-55296 ATGTAAAACCAGGTGACACTGGG - Intergenic
1123701558 15:22918040-22918062 ATGAAAATACAAATTACTCTGGG + Intronic
1124147133 15:27138340-27138362 ACGTAAATATGGTTCACTCTTGG + Intronic
1124665300 15:31586973-31586995 ATCTAAATACTGATGACTCCTGG + Intronic
1126083235 15:44986223-44986245 ATAGAAATACAGTGGTCTCTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127413116 15:58729505-58729527 ATGTGCATACAGATCACTCTGGG - Intronic
1128196620 15:65762884-65762906 ATGTAAGTACATTTGCCCCTTGG - Intronic
1128407782 15:67360789-67360811 ATGTAAATACAGCTCTATCTAGG - Intronic
1128879398 15:71229330-71229352 ATTTAAATACAGTTGTCCCTTGG + Intronic
1130627565 15:85531236-85531258 ATCTAAATACAGTGCAATCTGGG - Intronic
1133434578 16:5768065-5768087 ATTTAAATGCAGTCTACTCTTGG - Intergenic
1133539800 16:6738757-6738779 ATGTAAAGACAGTGAAATCTTGG + Intronic
1133942872 16:10325098-10325120 ATAAAAATACAGTTTCCTCTGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135476467 16:22780479-22780501 ATGTAAATACATTTTTTTCTGGG + Intergenic
1135687556 16:24510297-24510319 ATTTATATACAGTTGACCCTTGG - Intergenic
1135688548 16:24517690-24517712 ATTTATATACAGTTGACCTTTGG + Intergenic
1139026665 16:62826215-62826237 ATATAAATACAGTTGTCTCTTGG - Intergenic
1139278005 16:65745875-65745897 ATGTAAATAAAGTGGACTTTGGG + Intergenic
1140002694 16:71040817-71040839 ATTTAAATGCAGATGACACTTGG - Intronic
1140146350 16:72314083-72314105 ATGTAAATATAATTAACCCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152402174 17:80073614-80073636 ATTTCAATACTGTTGAGTCTTGG - Intronic
1154373821 18:13792034-13792056 ATGGAAATACAGTAGTCCCTTGG - Intergenic
1155100519 18:22605958-22605980 ATGTAACTATAGTTGCCTCAGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1159255313 18:65937513-65937535 ATGTAAATGAGGTTGATTCTGGG + Intergenic
1159688283 18:71451627-71451649 CTGTAAATGCAGTTTATTCTGGG + Intergenic
1163707293 19:18822261-18822283 ACGTAATTAAAGTTGACCCTTGG - Intergenic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1168368150 19:55807190-55807212 ATGAAAATAAAGTTAACTCCTGG + Intronic
924994595 2:346859-346881 ATTTAAATACAATTCAGTCTAGG - Intergenic
925398771 2:3556978-3557000 TTGGAAATACAGTTGTCCCTTGG + Intronic
925447239 2:3938346-3938368 ATGTATATTCTGTTGACTTTGGG + Intergenic
929295719 2:40244201-40244223 AAGTAAATACACTGCACTCTTGG + Intronic
929732072 2:44505765-44505787 AAGGAAGCACAGTTGACTCTTGG - Intronic
930418478 2:51119785-51119807 ATGCAAACAAAGTTGACCCTTGG + Intergenic
932223045 2:70015570-70015592 ATGTATTTACAGTTGTCCCTTGG - Intergenic
932700878 2:73990687-73990709 ATGTAAATCCAGTTGGCTGAGGG - Intronic
933061010 2:77736147-77736169 ATATATATACAGTTGACCCTTGG - Intergenic
933099447 2:78233688-78233710 TTGGAAATACAGCTGACTTTTGG - Intergenic
933197258 2:79406290-79406312 AGCTAAATAAAGTTGGCTCTGGG - Intronic
933361178 2:81286792-81286814 ATATATGTACAGTTAACTCTAGG + Intergenic
933533259 2:83537547-83537569 AAGTAAAGACAGTTAACTATAGG - Intergenic
933827806 2:86179345-86179367 TTGAAAATACAGTTGTCTTTTGG - Intronic
933881726 2:86676541-86676563 ATGTAAAGAGAGTTAACACTTGG - Intronic
934503361 2:94875124-94875146 ATGTAAAACCAGGTGACACTGGG + Intronic
937123759 2:119459861-119459883 ATGTTCATACAGCTGAATCTTGG + Intronic
937638117 2:124179725-124179747 TTGTAAATACATTTGTCTTTTGG - Intronic
938251315 2:129817686-129817708 ATGTTAATACAGTTGTCTCTTGG + Intergenic
938601038 2:132839406-132839428 GTATAAGTACCGTTGACTCTTGG + Intronic
939386532 2:141507238-141507260 ATATAAATACAGCTTACTATGGG + Intronic
941130708 2:161647204-161647226 ATGTAAATATTGTTAACTATGGG - Intronic
943264042 2:185703985-185704007 ATGTAAATACAATTAACTAGTGG - Intergenic
944283833 2:197925413-197925435 AAGTGAATACAGTAGACTCTTGG + Intronic
944645729 2:201779764-201779786 ATGTAAATGGATGTGACTCTGGG + Intronic
944995878 2:205292723-205292745 ATGAACATACAGTTGAATTTGGG + Intronic
946957484 2:224947369-224947391 ATATTATTACAGTTGACTTTTGG - Intronic
947882252 2:233527772-233527794 ATGTTAAAACAGTTTTCTCTTGG - Intronic
1169643907 20:7787784-7787806 ATGTAAATATAGTCAACTTTGGG + Intergenic
1171023192 20:21605301-21605323 ATCTAAAAACAGTTGACTGCAGG - Intergenic
1171913306 20:30987368-30987390 ATGTAAAGACCATTGACACTAGG + Intergenic
1172788123 20:37483535-37483557 ATATAAATATAATTGACTATAGG - Intergenic
1172944978 20:38680305-38680327 ATGCAAATACAGTTGGCTGGTGG - Intergenic
1173638749 20:44584180-44584202 ATGTAAATACAGTTTAGTTCAGG - Intronic
1176622668 21:9070042-9070064 ATGTAAAACCAGGTGACACTGGG - Intergenic
1176947355 21:14998961-14998983 TTGTGAATACAGTTGACCCTTGG - Intronic
1177131532 21:17262104-17262126 ATCTAAATGCTGTTGATTCTTGG - Intergenic
1177561729 21:22763687-22763709 AAGTGAATATAGGTGACTCTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182741057 22:32567792-32567814 AAGTAAAAACAGCAGACTCTGGG - Intronic
1183028593 22:35085075-35085097 ATGTAAAAACCTTTAACTCTAGG - Intronic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
951013813 3:17706404-17706426 GTGTAAGTAAAGTTGATTCTAGG - Intronic
953054183 3:39374601-39374623 ATGTAAGGACAGTTGGCCCTGGG - Intergenic
953859230 3:46528187-46528209 TTGTAAATGCAGTAGACTCTCGG - Intronic
955002123 3:54937349-54937371 ATGCAAATACAGTTGTCCCTCGG + Intronic
955144653 3:56304301-56304323 ATGAAAATACTGTTAACTTTGGG + Intronic
955914349 3:63891723-63891745 ATGTAAATATAGGTGACTATTGG + Intronic
957875770 3:86144318-86144340 ATTTAAGTACAGTTGTCCCTTGG + Intergenic
959248550 3:103907768-103907790 AAGCAAATACAGTTGGCCCTTGG + Intergenic
959416494 3:106081743-106081765 ATGTAAATTAAGTAGACTTTAGG - Intergenic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
961130492 3:124462098-124462120 ATGTAATTATTGTTGACTTTAGG - Intronic
961399827 3:126631456-126631478 AAGTAAATACAGTTAGCTCTAGG - Intronic
962134136 3:132715853-132715875 ATATGAATACAGTTGTCCCTTGG + Intronic
962972946 3:140421741-140421763 ATGTATAAAATGTTGACTCTGGG + Intronic
963157676 3:142116871-142116893 CTGTAAGTTCAGTTGACTCTTGG + Intronic
963335293 3:143968570-143968592 ATTTAAATACAGTTGTCTGTTGG + Intergenic
964551784 3:157892738-157892760 ATGATATTACAGTTCACTCTTGG - Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966587903 3:181648061-181648083 AAGTTAATACAGTTGTCTCTTGG - Intergenic
967109323 3:186279706-186279728 ATGTAAATAGAGAGGACTTTGGG + Intronic
967526538 3:190501549-190501571 ATGTTAATACATTTTCCTCTTGG + Intergenic
970240950 4:14008313-14008335 ATTTAAATACATTTGACCCTGGG - Intergenic
970965251 4:21920764-21920786 CAGTAAATACAGTTGTCCCTTGG - Intronic
971366278 4:25979555-25979577 AAGTAAATACAGTTACCCCTTGG - Intergenic
971612310 4:28741503-28741525 AAGTAAATTCAGTAGTCTCTTGG - Intergenic
971802391 4:31308843-31308865 ATGAAAATACAGTTAAGGCTGGG - Intergenic
972071572 4:35025473-35025495 TTGAAACTACAGTTGCCTCTAGG - Intergenic
972755830 4:42044741-42044763 ATGTAAATTCTGTTGACTTGGGG - Intronic
972849199 4:43027414-43027436 ATGAAGAAACAGTAGACTCTTGG + Intronic
972876340 4:43365647-43365669 AGGTATTTCCAGTTGACTCTAGG + Intergenic
973303221 4:48613658-48613680 ATGTAAATGCATTTGAGGCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974278065 4:59752646-59752668 AGGTAAATGCTGTTGACTCCAGG + Intergenic
974929333 4:68343872-68343894 ATGTAAATACTGTTTAATGTAGG - Intronic
975021713 4:69499327-69499349 ATGTATATTCTGTTGTCTCTGGG + Intronic
976891025 4:90048008-90048030 ATGCAAATGAAGTTGACTCTAGG + Intergenic
977383409 4:96307126-96307148 ATGTAAATAAAGTTGATTAGGGG + Intergenic
977771479 4:100866269-100866291 ATGTATATTCTGTTGATTCTGGG + Intronic
978115128 4:105010552-105010574 ATGTATATACTGTTGAATTTGGG + Intergenic
979249360 4:118548412-118548434 ATGTAAATACGCATGCCTCTAGG - Intergenic
979557115 4:122061756-122061778 AAGATAATACAGTTGACCCTTGG + Intergenic
980010690 4:127590850-127590872 ATGTAAAGACCATTGAGTCTAGG + Intergenic
980326593 4:131354304-131354326 ATGTAAAGACCGTTGAGACTAGG + Intergenic
981991363 4:150924832-150924854 ATGTTAATATAGTTGCCTATGGG - Intronic
984210601 4:176842545-176842567 ATGTACATACAGTTGTCCCTCGG - Intergenic
984500245 4:180549743-180549765 ATACAAATACAGTGGTCTCTTGG + Intergenic
987482274 5:18473734-18473756 ATGTAAAGACCGTTGAGACTAGG + Intergenic
987634075 5:20516460-20516482 ATTTTAATACAGGTGACTTTGGG + Intronic
989196326 5:38720147-38720169 ATGTAAATTCAGATGACTGGAGG - Intergenic
990531327 5:56676347-56676369 ATGTTAATACAAATGACTGTGGG - Intergenic
991374552 5:65953199-65953221 CTCTGCATACAGTTGACTCTTGG + Intronic
992838567 5:80664721-80664743 TTGTAATTAGAGTTGGCTCTTGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994849119 5:105031274-105031296 TTGTAAATTCAGTAGAGTCTTGG + Intergenic
995651014 5:114368249-114368271 ATATAATTACAGTTGTCCCTTGG - Intronic
996187458 5:120495316-120495338 TTGTAAATACATTAGTCTCTTGG + Intronic
996264920 5:121527414-121527436 ATGTAAATACAATAGATTATTGG + Intergenic
997446917 5:133947040-133947062 ATGGAAATACAATTGGGTCTGGG + Intergenic
998724972 5:145002012-145002034 GTGTAAAGATAGTTGACCCTTGG + Intergenic
1000102331 5:158028073-158028095 AGGTCCATACAGTTGATTCTCGG - Intergenic
1000700119 5:164438999-164439021 ATGTACATACATTTTACTCTAGG - Intergenic
1001005824 5:168048982-168049004 AGGTCAATACATTTGGCTCTGGG - Intronic
1003066404 6:2906953-2906975 CAGCAAATACAGTTGTCTCTTGG - Intergenic
1003967356 6:11265714-11265736 ATGTAAATACAGTTATCTTTAGG - Intronic
1005293949 6:24405701-24405723 ATGTTAACAAAGGTGACTCTAGG + Intronic
1008653586 6:53588418-53588440 ATTAAAAAACATTTGACTCTCGG - Intronic
1009035437 6:58112281-58112303 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009211252 6:60865873-60865895 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009538313 6:64919990-64920012 AGTTAAATACATTTGAATCTGGG + Intronic
1009612682 6:65966267-65966289 CTGTATCTACAGTTGCCTCTGGG - Intergenic
1009650128 6:66465291-66465313 CTGTCAAATCAGTTGACTCTTGG + Intergenic
1009903431 6:69838189-69838211 ATATATATACAGTTGACTTCTGG + Intergenic
1010886600 6:81250949-81250971 TTGGAAAAACAGTTGATTCTAGG + Intergenic
1011414484 6:87103193-87103215 CTGAAAATACATTTGACCCTTGG + Intergenic
1012635573 6:101535446-101535468 ATGTAAATAAAGTAGAGGCTAGG + Intronic
1012934089 6:105347535-105347557 ATATAAATACATTTAACTCAGGG - Intronic
1012969038 6:105706922-105706944 TCCTAAATACAGTTGACCCTTGG + Intergenic
1014041765 6:116835418-116835440 AAATACATACAGTTGACCCTTGG - Intergenic
1014070594 6:117176929-117176951 ATGTAAAGACCATTGACACTAGG + Intergenic
1017304856 6:152905390-152905412 ATTTGATTACAGGTGACTCTGGG + Intergenic
1017475577 6:154788057-154788079 AAGTAGATACAGTAGCCTCTTGG + Intronic
1019205272 6:170356522-170356544 AACTAAATACAGTTGTGTCTTGG + Intronic
1019856822 7:3617554-3617576 ATGGAAGTATATTTGACTCTTGG + Intronic
1021098403 7:16559653-16559675 ATTTAAAAACAGTTACCTCTCGG - Intronic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1022714493 7:32886626-32886648 ATAGAAACACAGTTGTCTCTTGG - Intronic
1022744151 7:33152470-33152492 ATGTTAGTACATTTGACTATAGG + Intronic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1024560715 7:50643020-50643042 AGGAAAATACATTTGACCCTTGG + Intronic
1024845976 7:53642919-53642941 TTGGAAAAACAGTTGATTCTAGG - Intergenic
1026022530 7:66720844-66720866 ATGGAAATTCAATTGACACTTGG - Intronic
1026523177 7:71133276-71133298 ATGTCAGTACAGTTGGCTCCCGG + Intronic
1027302074 7:76850098-76850120 ATGTAAACACATTTCACTATGGG - Intergenic
1027335453 7:77145883-77145905 ATGTATATTCTGTTGATTCTGGG + Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027930869 7:84533400-84533422 ATGTAAAGGCAGTACACTCTGGG - Intergenic
1028307446 7:89283771-89283793 ATACATATACAGTTGACCCTAGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029780339 7:102725214-102725236 ATGTATATTCTGTTGATTCTGGG - Intergenic
1029799523 7:102931626-102931648 ATATAAATACAGTTCATTTTGGG + Intronic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1031224595 7:119019937-119019959 TTGTAAATATAGTTGTATCTAGG + Intergenic
1031558081 7:123203014-123203036 ATTTGAATACAGTTGGCTCAAGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1031917490 7:127576840-127576862 ATGTGACTAGAATTGACTCTGGG - Intergenic
1032013920 7:128364143-128364165 ATGTAAATCAAGTTGGCTCTTGG - Intergenic
1034047830 7:147948681-147948703 ATATATATACAGTTGACCCTTGG + Intronic
1035871171 8:3137546-3137568 ATAGAAATACAGTTGTCCCTTGG + Intronic
1036196884 8:6726106-6726128 ATCTAATTACATTTCACTCTTGG + Intronic
1036421914 8:8604503-8604525 ATGTGATTACAGTTGTCCCTTGG - Intergenic
1036628673 8:10494942-10494964 ATATAAATGCAGTTGTCCCTTGG - Intergenic
1037085483 8:14844066-14844088 ATATTTATACAGTTGACCCTTGG + Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039934063 8:42024636-42024658 GAGTAAAAACAGTTGACTCATGG - Intronic
1040851585 8:51906024-51906046 ATAAAAATACAGTTGCCCCTCGG - Intergenic
1041160504 8:55037648-55037670 AAGGAAATCCAGTTGTCTCTTGG + Intergenic
1041216396 8:55605721-55605743 ATGTGAGTACAGCTGCCTCTTGG + Intergenic
1041417239 8:57624498-57624520 ATGTAAATTCACTTGACCATGGG - Intergenic
1041812017 8:61922148-61922170 ATGAGAATAGAGTTGACTTTGGG + Intergenic
1042051808 8:64718232-64718254 TTGTTAATACCATTGACTCTTGG - Intronic
1042478123 8:69272787-69272809 GAGTGAATACAGTTGTCTCTTGG + Intergenic
1043713320 8:83449059-83449081 ATGTAAAGACCATTGAGTCTAGG + Intergenic
1044222114 8:89681119-89681141 ATGTACATTCTGTTGAATCTGGG - Intergenic
1044478293 8:92654585-92654607 GAGCAAATACAGTTGACTCGGGG - Intergenic
1045816499 8:106282826-106282848 TTATTAATACAGTTGACCCTTGG - Intronic
1045985665 8:108247017-108247039 TTCTAAGTACATTTGACTCTTGG - Intronic
1046183433 8:110682769-110682791 ATCTATATACAGTTGATTCTGGG + Intergenic
1046287810 8:112117876-112117898 ATATATATACAGTTGTCCCTTGG - Intergenic
1047379793 8:124349178-124349200 ATGCACATACAATTGATTCTTGG - Intronic
1048665347 8:136655190-136655212 ATATAAATCCAGTTTATTCTTGG - Intergenic
1049050015 8:140187312-140187334 TTGCAAATACAGTTGTCCCTTGG - Intronic
1049123443 8:140762115-140762137 ATGTAAAAATATTTGGCTCTTGG - Intronic
1049999324 9:1059692-1059714 ATGTGAATCCAGTTGGCTGTGGG + Intergenic
1050466617 9:5932368-5932390 AGGGAAGTACAGTTGACCCTAGG + Intronic
1050653325 9:7796986-7797008 ATATATATACAGTTGACCCTTGG - Exonic
1051568781 9:18531243-18531265 ATGAAAATCCAGATCACTCTTGG + Intronic
1052462420 9:28783195-28783217 ATGAATATACAGTTGTCCCTTGG + Intergenic
1052491344 9:29173220-29173242 ATGTCAACTGAGTTGACTCTTGG - Intergenic
1058896903 9:109408311-109408333 ATTTACTTACAGGTGACTCTGGG + Exonic
1061575055 9:131501159-131501181 CTGTAAATACAGTTGCCTGCAGG + Intergenic
1203745859 Un_GL000218v1:40470-40492 ATGTAAAACCAGGTGACACTGGG - Intergenic
1203564250 Un_KI270744v1:79012-79034 ATGTAAAACCAGGTGACACTGGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186917432 X:14238532-14238554 ATGCAAATCCAGTTGCCTGTGGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1188351126 X:29132083-29132105 ATGTTAATACGCTTAACTCTAGG + Intronic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1189095928 X:38139496-38139518 ATGAAATTACGTTTGACTCTTGG - Intronic
1189430421 X:40941725-40941747 ATGTATATACAGTCGGCCCTTGG + Intergenic
1190764919 X:53468051-53468073 AGGTAGAAACAGTTGTCTCTAGG + Intergenic
1191819404 X:65286675-65286697 ATGTATATGCATTTGATTCTTGG - Intergenic
1191825315 X:65358359-65358381 ATGTATATTCTGTTGACTTTGGG - Intergenic
1192347384 X:70322195-70322217 ATGTAAATATAGTTGACTGTGGG + Intronic
1193804188 X:85973570-85973592 AAGCAAATACAGTAAACTCTTGG + Intronic
1193806814 X:86004939-86004961 ATGTATATTCTGTTGACTTTGGG - Intronic
1195636697 X:107125006-107125028 AACGATATACAGTTGACTCTTGG + Intronic
1196679954 X:118460543-118460565 AAGTATATACAGTTGTCCCTCGG - Intergenic
1201159185 Y:11155482-11155504 ATGTAAAACCAGGTGACACTGGG - Intergenic
1201543521 Y:15134917-15134939 ATGTATATTCTGTTGACTTTTGG - Intergenic
1201595731 Y:15666827-15666849 ATGTAAAGACCATTGACACTAGG - Intergenic