ID: 1094457841

View in Genome Browser
Species Human (GRCh38)
Location 12:30658772-30658794
Sequence CCTTCTGTATTGAAACTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094457841_1094457843 26 Left 1094457841 12:30658772-30658794 CCATTTAGTTTCAATACAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1094457843 12:30658821-30658843 AAATAAAAATTAAGCCCTTTAGG 0: 1
1: 0
2: 4
3: 81
4: 773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094457841 Original CRISPR CCTTCTGTATTGAAACTAAA TGG (reversed) Intronic
900852521 1:5155192-5155214 CCTTCTTTATTGGAAATACATGG + Intergenic
901403248 1:9028878-9028900 CCATCTCTATTGAAAATACATGG - Intergenic
904826229 1:33275733-33275755 CCTTCTGTATGGAACCTACGGGG + Intronic
905415980 1:37804525-37804547 CCTTCTGTTTTAAGACTATATGG - Intronic
905654596 1:39677883-39677905 GCTTGTGAATTGAAACTAAGAGG + Intergenic
906456688 1:46003291-46003313 CCTTCTTTTTTGAAAGAAAAAGG - Intronic
907086583 1:51681050-51681072 CCTCCTTTTTTGAAAGTAAAAGG + Intronic
908924497 1:69238156-69238178 GCTTCTGTATTGAGAATAAATGG + Intergenic
912534859 1:110359598-110359620 ATGTCTGTATTGAAACAAAAAGG - Intergenic
912606008 1:110989885-110989907 CTTTCTGCCTTCAAACTAAAAGG - Intergenic
917068119 1:171120004-171120026 CCTTCTGGATTTCAACCAAAAGG - Intergenic
917150101 1:171933852-171933874 CCTCCTCTATTGCAACCAAATGG + Intronic
917845587 1:179017338-179017360 CCTTCTGAGTTGAAACCAACAGG - Intergenic
919140078 1:193559534-193559556 CCCACTGCACTGAAACTAAAAGG - Intergenic
919647960 1:200115008-200115030 CCTTTTTTATTGAGACTAAATGG + Intronic
919661525 1:200252396-200252418 CCTTCTTTGTTGAAAAGAAAAGG - Intergenic
921063311 1:211604804-211604826 CCTCCTGTATGGAAACTCATAGG + Intergenic
923969587 1:239184862-239184884 CTTCCTGTAAGGAAACTAAATGG - Intergenic
923980843 1:239321388-239321410 CCTTCTCTATTAAAATAAAATGG + Intergenic
1067957860 10:50812994-50813016 TCTTCTGGATTGAAATTATAAGG + Intronic
1069030722 10:63593220-63593242 GCATCTGTATTAAAACTAATAGG + Intronic
1071560225 10:86640593-86640615 CTTCCTGTAAGGAAACTAAATGG - Intergenic
1071832119 10:89382085-89382107 CATTCTTTTTTGAAAATAAAGGG - Intronic
1076026690 10:127121273-127121295 CCATCTGTTTTGGAACTAATGGG + Intronic
1077680967 11:4239544-4239566 GCTTCTTTATTTAAACTATAAGG + Intergenic
1077685253 11:4284985-4285007 GCTTCTTTATTTAAACTATAAGG + Intergenic
1077689935 11:4332944-4332966 GCTTCTTTATTTAAACTATAAGG - Intergenic
1080789955 11:35513738-35513760 CCACCTGTATTGAAACTACCTGG + Intronic
1080970047 11:37263101-37263123 CCTTCTGTGTTTAAAATAAAAGG + Intergenic
1084217228 11:67654990-67655012 CCTTCTGAAATGTAACTTAAAGG + Intergenic
1084221076 11:67679718-67679740 CCTTCTGAAATGTAACTTAAAGG - Intronic
1087647601 11:100826823-100826845 CCTTCTGTATAGAAAACCAACGG - Intronic
1088044613 11:105433093-105433115 CCTTCTGTTAGGAAAATAAAAGG - Intergenic
1089235994 11:117025966-117025988 CCATTTGTATTGAAAAAAAATGG + Intronic
1089863054 11:121607178-121607200 CCTGCTGTATTCTACCTAAAGGG - Exonic
1089910499 11:122094877-122094899 CCTTCTGTATAGTATCCAAAGGG + Intergenic
1091008863 11:131980041-131980063 CTTGCTGTTTTGAAACTAAATGG + Intronic
1094415125 12:30208040-30208062 CTTTTTGTATTGAGAATAAAAGG + Intergenic
1094457841 12:30658772-30658794 CCTTCTGTATTGAAACTAAATGG - Intronic
1095378598 12:41561111-41561133 CCAACTGTAAAGAAACTAAAAGG + Intronic
1095544522 12:43349161-43349183 CTTTCTATATTTAAAATAAAGGG + Intergenic
1098091813 12:66910463-66910485 AAATCTGTATTGAAACCAAAAGG + Intergenic
1098146774 12:67505473-67505495 CATTCCATAGTGAAACTAAATGG - Intergenic
1098491139 12:71080532-71080554 CCATCTGTAAGAAAACTAAAAGG - Intronic
1098833051 12:75387007-75387029 CCTTTTGTGTTGTATCTAAAAGG - Intronic
1107457520 13:40568508-40568530 CCTTCTGTTTGCAAACAAAATGG - Intronic
1109250373 13:60012516-60012538 CTTTCTGAATTGAATCTAAGTGG - Intronic
1109877437 13:68424337-68424359 TCTTCAGTATTGAAAATCAATGG + Intergenic
1110425263 13:75359877-75359899 CCTTATGAATTGAAATTAATTGG - Intronic
1111014726 13:82364519-82364541 GCTTCTGTTTTAAGACTAAATGG - Intergenic
1112051488 13:95647731-95647753 CCATCTGTTTGGAAACAAAATGG + Intergenic
1112733249 13:102390404-102390426 TATTCTGTCCTGAAACTAAAAGG - Intronic
1113050193 13:106202699-106202721 CCTCCTCTATTGAAATGAAATGG - Intergenic
1113447722 13:110382714-110382736 CCTCCTGTATTCAAACTTTAAGG + Intronic
1113950475 13:114068681-114068703 CCTTATTTACTTAAACTAAAAGG - Intronic
1115715576 14:36099338-36099360 CCTTCTGTATTGAATATTCAGGG - Intergenic
1118146076 14:63138764-63138786 TTTTCTCTATAGAAACTAAAAGG - Intergenic
1119831525 14:77707320-77707342 CCCTCCGTGTTGAAAATAAATGG - Intronic
1129176839 15:73846509-73846531 CCTTCTGTATTTAAACAAGTGGG - Intergenic
1130569427 15:85027437-85027459 CCTTCAGTGTTGAAATCAAAAGG + Intronic
1130605956 15:85317076-85317098 CCTTCAGTAGGAAAACTAAATGG + Intergenic
1135390591 16:22089967-22089989 CCTTTTTTTTTGAAACCAAAGGG - Intergenic
1137272603 16:46912180-46912202 GTTTCTGTCTTGAAACCAAAAGG - Intronic
1138973398 16:62173363-62173385 TCTTCTGTTTGGAAATTAAAAGG + Intergenic
1139081856 16:63531345-63531367 CCTTCTGCAATAAAACAAAATGG + Intergenic
1139555659 16:67708233-67708255 AGTTCTGTAATCAAACTAAATGG + Intronic
1139704083 16:68728464-68728486 CCATCTCTATTGAAAATACAAGG - Intergenic
1140633647 16:76884828-76884850 GCTTCTCTACTGGAACTAAAGGG - Intergenic
1145071646 17:19814714-19814736 CTTTCTCTACAGAAACTAAAAGG - Intronic
1147041403 17:37722185-37722207 CCTTCCCGATTGAAACTACAAGG + Intronic
1147682136 17:42256454-42256476 CCTGCTGTATTGAGATTAAAGGG + Intronic
1150021564 17:61620288-61620310 GCTTGTTTATTGAAAGTAAATGG + Intergenic
1150515948 17:65809305-65809327 TCATCAGTATTGAAACAAAATGG - Intronic
1203182782 17_KI270729v1_random:79526-79548 CATTCTGTATTGGAAGTAATTGG - Intergenic
1156975002 18:43210187-43210209 CCTTTGGTATTGTATCTAAAAGG - Intergenic
1157249278 18:46080383-46080405 CCTTCTGTGTGGCAACAAAATGG - Exonic
1158388130 18:57018179-57018201 CATTCTGTTTTGAAACTGAGGGG + Intronic
1158627785 18:59086719-59086741 CCTTCTGTAACGAAACTGCAAGG - Intergenic
1159372936 18:67552259-67552281 CCTTCTGAATGGAAACTTACGGG - Intergenic
1160760265 19:780602-780624 CCATCTCTATTAAAAATAAAAGG - Intergenic
1164529277 19:29035849-29035871 ACTTCTGAAATGCAACTAAAGGG - Intergenic
926516115 2:13849263-13849285 CATACTGTAATGAAACAAAAAGG - Intergenic
930553197 2:52861683-52861705 ACTTCTTCATTGAAACTAAAAGG - Intergenic
932599875 2:73116316-73116338 CCTTCTTTATTGACTTTAAATGG - Intronic
935632976 2:105227220-105227242 CCTGCTGTGCTGAACCTAAATGG + Intergenic
937354007 2:121186692-121186714 GCTTCTGTATGGAAACTTAAGGG - Intergenic
937710247 2:124972527-124972549 CATTCTGTCCTGCAACTAAAAGG + Intergenic
938746456 2:134282947-134282969 CCTTCTGTATTAGAATTAAAAGG - Intronic
939455956 2:142435853-142435875 ATTTCTGTGTTGAAACTTAATGG + Intergenic
941328411 2:164145346-164145368 CCTTCAGTATTGAAAGTGGAGGG - Intergenic
941464705 2:165812337-165812359 GCTTCTGCAATGTAACTAAAAGG - Intergenic
944273374 2:197806750-197806772 TCTACTGTATTGATACTACATGG + Intronic
946687259 2:222283010-222283032 GCTTCTGCATTGAGACCAAATGG - Intronic
949081770 2:242106519-242106541 CCTTCTGTATCTAAAATAAAAGG - Intergenic
1174712742 20:52724644-52724666 ACCTCTGTAAAGAAACTAAAAGG - Intergenic
1177152319 21:17467385-17467407 CCTTAAGTATTGAAAATAAATGG + Intergenic
1178353365 21:31889377-31889399 CCTACTTTAGTGAAACCAAATGG + Intronic
1183266179 22:36827181-36827203 TCTGCAGTATTGAAACAAAATGG - Intergenic
1184346240 22:43914991-43915013 CCTTTTGTTTTGCACCTAAATGG - Intergenic
949634393 3:5967162-5967184 CCTTTTCTCTTGAAACTAGATGG + Intergenic
950823190 3:15785172-15785194 CCTTTGGTATTGTATCTAAAAGG - Intronic
951050978 3:18093085-18093107 TGTTCTGTATTTTAACTAAATGG + Intronic
951566639 3:24018545-24018567 CCTCCTGTATTGGAACCAATAGG - Intergenic
952748917 3:36808256-36808278 CTTTCTGTATTGTAATTTAATGG - Intergenic
953447155 3:42978459-42978481 CCTCCAGTACTGAAACTAACAGG - Intronic
956571283 3:70698672-70698694 GTTTCTGTATTGAAACCCAATGG - Intergenic
959321410 3:104879947-104879969 TCTTCAGTATTGAAATGAAAAGG + Intergenic
959664808 3:108909191-108909213 CATTTTGCATTGAAACCAAAAGG - Intronic
960167335 3:114418238-114418260 ATTTCTGTATTGAAATTCAAAGG - Intronic
960482046 3:118203729-118203751 ACTTCTGTTTTGAAAAGAAATGG + Intergenic
960714583 3:120562641-120562663 CCATCTCTATTGAAAAAAAAAGG + Intergenic
963349087 3:144131104-144131126 CCTTTTATATTGAAAATAAAAGG + Intergenic
963548432 3:146691464-146691486 CTTTTTGTATTGAATCTAATTGG + Intergenic
966028589 3:175317141-175317163 CGTTCTGTATTGATTATAAAAGG + Intronic
967556608 3:190865960-190865982 CCTTTTGTATTGTGTCTAAAGGG + Intronic
972196893 4:36664587-36664609 TCTTCTGGATTGAGACAAAAGGG + Intergenic
973001494 4:44957280-44957302 ACTTCTATATTGAATCTGAATGG + Intergenic
973692155 4:53446788-53446810 TATTCTGTAATGAAACTGAATGG - Intronic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
978036067 4:103996430-103996452 TATTCTTTATTCAAACTAAATGG - Intergenic
978171342 4:105673977-105673999 TCTTCTGTTCTAAAACTAAAAGG - Intronic
980382424 4:132040884-132040906 CCTCCTAGATTGACACTAAATGG + Intergenic
980547196 4:134281075-134281097 CCTTCTGTAAGGAAAAAAAAAGG + Intergenic
980918047 4:139052869-139052891 CTTTCTTTATTGTAACTATAAGG + Intronic
987965015 5:24861213-24861235 CCTTCTGTTTTCAAATTAGATGG - Intergenic
996892807 5:128442468-128442490 CCTTCTTCATTTAAATTAAATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000567922 5:162874007-162874029 CCTTCTGTATAACAACAAAATGG + Intergenic
1011767205 6:90635278-90635300 CCTTCACTATTGCAACTGAATGG + Intergenic
1011857643 6:91714992-91715014 CCTTTTGTATTTAAATTCAATGG + Intergenic
1012043997 6:94245736-94245758 ACTTAGGTTTTGAAACTAAAAGG - Intergenic
1014691381 6:124567720-124567742 CTTTCTGAATTAAAACCAAAAGG - Intronic
1016348620 6:143143175-143143197 CCTTCTGTTTTGATATTAAGGGG + Intronic
1016718357 6:147261895-147261917 CTATTTCTATTGAAACTAAATGG + Intronic
1018212728 6:161497661-161497683 CCTTCTGAATTGAAAGGGAAAGG - Intronic
1018832637 6:167456363-167456385 CCTACTGTATGGAGGCTAAATGG - Intergenic
1021762042 7:23911681-23911703 CCTTCTGTAATGGAATTAGATGG + Intergenic
1022189664 7:28005000-28005022 CTTTCTGTATAGAAAGTGAAAGG - Intronic
1024494299 7:50026360-50026382 CCTTCAATATTGAATATAAAAGG + Intronic
1025704998 7:63855133-63855155 CCTTTTGGTTTGAAACTAACAGG + Intergenic
1025823305 7:64991626-64991648 CCATCTATGATGAAACTAAAAGG - Exonic
1026419069 7:70214130-70214152 CCTTCTGTTTTAAAGCAAAAGGG - Intronic
1031467497 7:122130971-122130993 CCTTCTGTATAAGAACAAAAGGG + Intronic
1035909226 8:3547367-3547389 TCTTCAGTGTGGAAACTAAATGG - Intronic
1036460271 8:8946441-8946463 CCCTCTGTATTGACAGGAAAAGG - Intergenic
1036827774 8:11991754-11991776 CTATCTGTATGGAAACAAAATGG - Intergenic
1038696535 8:29811664-29811686 GCTTCTGTGTTTAAACAAAAGGG - Intergenic
1040507591 8:48064673-48064695 ACTCCTTTATTGAAACAAAATGG - Exonic
1041457712 8:58078230-58078252 CCTTGTTTAAGGAAACTAAAAGG + Intronic
1041863476 8:62540822-62540844 CCTTCAGTCTTGAAAAAAAAGGG + Intronic
1041976742 8:63807928-63807950 CCTTCTGAAGTAAAATTAAAAGG - Intergenic
1042618599 8:70677509-70677531 TTTTCTGTAGTGAAATTAAAGGG - Intronic
1044617028 8:94152835-94152857 CCTTCTCTACTAAAAATAAAAGG - Intronic
1048059501 8:130903419-130903441 CCCTCTGTTATTAAACTAAAGGG - Intronic
1048206136 8:132416863-132416885 CCCTCTGAACTGAAACTGAAAGG + Intronic
1055147304 9:72951738-72951760 CCATTTGTAGTAAAACTAAATGG + Intronic
1055287869 9:74749279-74749301 ACTTCTTTATTGATACTATAGGG - Intronic
1055294637 9:74821633-74821655 TCTTCTTTTTTGAAACTATAGGG - Intronic
1055736313 9:79334723-79334745 CTTTATGCATAGAAACTAAAGGG - Intergenic
1056345328 9:85688568-85688590 CCTACTCTATAGAAACTAAAAGG + Intronic
1059256896 9:112939094-112939116 CCTTCTGTATCAAAACTTCAGGG - Intergenic
1060515277 9:124261739-124261761 CCTTCGGTGTTGAAAGGAAAAGG + Intronic
1061881213 9:133570105-133570127 CCATCTGTTTTGAAACAAATTGG - Intronic
1185547507 X:957229-957251 TCTTCGATTTTGAAACTAAATGG + Intergenic
1188250621 X:27889045-27889067 TCTTCTGATTTGAAATTAAATGG - Intergenic
1188929360 X:36087438-36087460 CCTTCTGCACTCAATCTAAATGG + Intronic
1189159043 X:38791956-38791978 CCTTCTGAATTGAGACCTAAAGG + Intergenic
1190212747 X:48460879-48460901 CCTTCTGTTTGGAAACTGACAGG + Intronic
1191058533 X:56269801-56269823 CTTTCAATATTGAAACTAATTGG + Intronic
1194594407 X:95839073-95839095 CCTCCTGAATCTAAACTAAAAGG + Intergenic
1194642112 X:96414595-96414617 ACTTCTGTAATAAAACAAAATGG + Intergenic
1195028626 X:100904448-100904470 CCTTTGGTATTGTATCTAAAAGG - Intergenic
1195130329 X:101844619-101844641 CCTGCTGTGTTGAAAATAGATGG - Intronic
1195175944 X:102315657-102315679 CCTCCTGTGTTGAAAATAGATGG + Intronic
1195182920 X:102371436-102371458 CCTCCTGTGTTGAAAATAGATGG - Intronic
1199693017 X:150323322-150323344 CCTTCTGAAAGAAAACTAAAAGG + Intergenic