ID: 1094459709

View in Genome Browser
Species Human (GRCh38)
Location 12:30682159-30682181
Sequence TTTGGTTACCATATCCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094459706_1094459709 14 Left 1094459706 12:30682122-30682144 CCACTCTGTAAAATTTCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 223
Right 1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG 0: 1
1: 0
2: 2
3: 6
4: 172
1094459707_1094459709 -2 Left 1094459707 12:30682138-30682160 CCAGCTTATTATATCTCATATTT 0: 1
1: 0
2: 1
3: 38
4: 431
Right 1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG 0: 1
1: 0
2: 2
3: 6
4: 172
1094459704_1094459709 29 Left 1094459704 12:30682107-30682129 CCAATGAATCTACCTCCACTCTG 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG 0: 1
1: 0
2: 2
3: 6
4: 172
1094459705_1094459709 17 Left 1094459705 12:30682119-30682141 CCTCCACTCTGTAAAATTTCCAG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG 0: 1
1: 0
2: 2
3: 6
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094459709 Original CRISPR TTTGGTTACCATATCCTGAA TGG Intronic
900627458 1:3615492-3615514 TTTGGCTATGATTTCCTGAAAGG - Intergenic
902735388 1:18397423-18397445 TTTTGTTATCATAGCCAGAATGG + Intergenic
903561318 1:24230200-24230222 CTTGCTTACCACACCCTGAATGG - Intergenic
905049003 1:35032322-35032344 TTTAGTGCCCATTTCCTGAAAGG + Intergenic
905260159 1:36711629-36711651 TTCAGTCACCATATCCTGCAGGG + Intergenic
905636724 1:39558914-39558936 TATGGTGACAATTTCCTGAATGG + Intergenic
906965635 1:50453835-50453857 TTTAGTTGCCATATCCACAAAGG + Intronic
907567405 1:55448712-55448734 TTTAGCCACCAAATCCTGAAAGG + Intergenic
907607306 1:55830762-55830784 TCTTGTCACCATATCTTGAAGGG + Intergenic
907705017 1:56825466-56825488 TTAGGTAAGCATTTCCTGAATGG - Intergenic
910255670 1:85244834-85244856 CTTGTTTACCATTTTCTGAAAGG - Intergenic
911520913 1:98929425-98929447 TTTCTTTACAATATCCTTAATGG + Intronic
911750664 1:101493575-101493597 TTTAGTTATCAAATCCTTAAAGG - Intergenic
911770367 1:101733200-101733222 TTTGGGTACTATATCCTTCAAGG - Intergenic
911870706 1:103094383-103094405 TTTAGTTACCATATCATAGAAGG - Intronic
914437986 1:147677476-147677498 TTTTGTTACAGCATCCTGAATGG - Intergenic
915613529 1:157015669-157015691 AATGGTCACAATATCCTGAAGGG + Intronic
916321966 1:163513963-163513985 TTTGGTCATGATTTCCTGAATGG - Intergenic
919865013 1:201774723-201774745 TTTGGATAAGATATCCTGATGGG - Intronic
921518241 1:216124782-216124804 TATGGTGACCTTCTCCTGAAGGG + Intronic
922981377 1:229829778-229829800 TCTTGTTGCCATATCTTGAAGGG - Intergenic
924012177 1:239677159-239677181 TTAGCTTTCCACATCCTGAATGG + Intronic
1065375145 10:25032144-25032166 ATTGGAAACCATATCCTGGATGG + Intronic
1066101358 10:32121495-32121517 ATTTCTGACCATATCCTGAAGGG - Intergenic
1067156031 10:43782073-43782095 TTTGGTTTCTATATGCAGAAGGG + Intergenic
1067343986 10:45424995-45425017 TTTGGCTACCAGTTCCTGAATGG + Exonic
1074703306 10:116110809-116110831 GTTGGATTCCATATCCTAAAGGG - Intronic
1075674225 10:124284885-124284907 TTTGGTTTGCATTTCCTAAATGG - Intergenic
1077332985 11:1991424-1991446 TGTGGTTACCACAGCCTTAAGGG + Intergenic
1077521259 11:3036452-3036474 TTTGGTTTGCATTTCCTTAATGG - Intronic
1078963256 11:16304600-16304622 TTTTGTTACAGTAGCCTGAATGG + Intronic
1080024172 11:27596419-27596441 TTTTGTTACAGCATCCTGAATGG + Intergenic
1086003216 11:82004148-82004170 ATTGGTAACAATATCCAGAAAGG - Intergenic
1086007582 11:82056371-82056393 TTTGGTTACAATAGCCTGAAAGG + Intergenic
1086019299 11:82207148-82207170 TGTGGTTATCTTCTCCTGAAGGG - Intergenic
1086619223 11:88865159-88865181 TTTGGTTACTATAGCTTGATGGG - Intronic
1088396761 11:109377838-109377860 TTTCCTAACCATATCTTGAAAGG - Intergenic
1091026258 11:132143942-132143964 TTTGATGACAATATCCAGAATGG - Intronic
1202815968 11_KI270721v1_random:46600-46622 TGTGGTTACCACAGCCTTAAGGG + Intergenic
1094301947 12:28974319-28974341 TTTGGATACCATTGACTGAAAGG - Intergenic
1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG + Intronic
1097464108 12:59901322-59901344 TTTTGTTATAATAGCCTGAATGG + Intergenic
1100563443 12:95771952-95771974 TTGGGTTACCATAGTCAGAATGG - Intronic
1100722018 12:97369254-97369276 TGTGGTTTCCATCTCCTGACTGG + Intergenic
1102150291 12:110684993-110685015 TTTGCCTACCACACCCTGAAGGG - Intronic
1105227905 13:18454098-18454120 TTTGTCTAACACATCCTGAATGG - Intergenic
1106904794 13:34394111-34394133 TTTAGTTACCATTTATTGAATGG + Intergenic
1108694132 13:52887842-52887864 TTAGGGTACCATCTCCTGAGGGG - Intergenic
1109450239 13:62504755-62504777 ATTGGTAATCATATCCTGGAAGG - Intergenic
1109474848 13:62865872-62865894 TGAGGTTTCCGTATCCTGAATGG + Intergenic
1110031657 13:70622651-70622673 TTTGGTTATAATTTCCTGAAAGG + Intergenic
1110091408 13:71453127-71453149 TTAGGTTACCTTGTCCTGATTGG + Intronic
1114160131 14:20156151-20156173 ATTTGTTCCCATGTCCTGAATGG - Intergenic
1114166779 14:20226686-20226708 TTTTGTTAACATTTCCTGTAGGG - Intergenic
1115515962 14:34185260-34185282 TTTGGTTACTGTAGCCTGGAAGG - Intronic
1116883576 14:50196131-50196153 TGTGGTTACCAGAGGCTGAAGGG + Intronic
1119021646 14:71121362-71121384 TTTGCCTACCATCTCCTGATTGG + Intergenic
1119876178 14:78061289-78061311 TTTAGTTATCACAGCCTGAATGG + Intergenic
1119906233 14:78304622-78304644 TTTGGTAACCTCATCCAGAACGG - Intronic
1120110202 14:80545249-80545271 GTTGGTTATCACATGCTGAATGG + Intronic
1120399947 14:84018222-84018244 TTTGGTTACTTTTTCCTCAAGGG - Intergenic
1126199242 15:45967037-45967059 TTTGGTTTGCAGCTCCTGAAAGG - Intergenic
1127348138 15:58121794-58121816 GTTGGTTGCCATAAACTGAAAGG - Intronic
1128915693 15:71559838-71559860 TGTGGTTAGCATATCGTGAGAGG + Intronic
1130873650 15:87993203-87993225 TTTGCTCATCATATCCTAAATGG - Intronic
1133629273 16:7603896-7603918 TTTGGTCACCATGACCAGAATGG + Intronic
1133669546 16:8004909-8004931 TTTGGTTGCCATAATCTGCAGGG - Intergenic
1133837597 16:9380633-9380655 TTTTGTTATCACAGCCTGAATGG - Intergenic
1138006057 16:53338838-53338860 GTTGGTTACAATGTCCTTAAAGG - Intergenic
1138664165 16:58549411-58549433 ATTGGTTAGCATATTCTGTATGG - Intronic
1141895525 16:86956502-86956524 TTTGGTCACCCTCTCCTCAAGGG - Intergenic
1143626208 17:8111474-8111496 TTTGGGTACCAGTACCTGAATGG - Exonic
1149358111 17:55864958-55864980 TTTTGTTACTGCATCCTGAATGG + Intergenic
1149404179 17:56330043-56330065 TTTGGTTACAGCAGCCTGAAGGG + Intronic
1150918416 17:69459351-69459373 TTTAGTTCCCATATTCTCAAAGG - Intronic
1154525474 18:15285369-15285391 TTTGTCTAACACATCCTGAATGG + Intergenic
1158370394 18:56795624-56795646 TTTGGTAATCATATCATGTATGG - Intronic
1159733926 18:72070295-72070317 TTTTGTTAGCATTTCCTGCAGGG + Intergenic
1163859050 19:19731218-19731240 TTTGGGTACCCTATCCTGAAAGG - Intronic
1168579144 19:57539191-57539213 TGTGCTTACCAAATTCTGAAGGG + Exonic
926815998 2:16797977-16797999 ATTGATTACAATATCCTTAAGGG + Intergenic
929651736 2:43686601-43686623 TTTGCTTTCCATATAATGAAGGG - Intronic
931320664 2:61172196-61172218 TTTGGTAACCTAATCCTGTAAGG + Intergenic
931922654 2:67037874-67037896 TTTGTTTTCCACAACCTGAAAGG - Intergenic
932410489 2:71544167-71544189 TGTGGTTTCCATATCCTGGTTGG + Intronic
932525591 2:72463785-72463807 TTTTGTTACATTATTCTGAATGG - Intronic
935843077 2:107134561-107134583 TTTTGTTACTATTTCCTAAAAGG + Intergenic
939539943 2:143481585-143481607 TTTGGTTCCCATACCCTAAATGG + Intronic
939544158 2:143532060-143532082 TTTGGTGACCTTGTCCTGTATGG - Intronic
940593219 2:155755723-155755745 TTTGGTAGCAATATCCTTAATGG - Intergenic
942179815 2:173369932-173369954 TTTGGATGCCTTATCCTTAAAGG + Intergenic
943165754 2:184323577-184323599 TTTGACTATCAAATCCTGAATGG + Intergenic
1168988178 20:2069315-2069337 TTTGCTTAACATTTCCTGCAAGG - Intergenic
1173848675 20:46203861-46203883 TTTGGTGACAACAACCTGAAGGG + Intronic
1180518996 22:16176791-16176813 TTTGTCTAACACATCCTGAATGG - Intergenic
1181360240 22:22328488-22328510 TTTGGTTTCCATTTTCTGGAAGG + Intergenic
1181879166 22:25963996-25964018 TTTGTTTATCATATACTGTATGG + Intronic
1182071797 22:27469030-27469052 TCTGGTCACCATGTCATGAATGG - Intergenic
950830816 3:15874129-15874151 TTTTGTTAATATATACTGAATGG + Intergenic
951460862 3:22950232-22950254 TTTGGTTGCCACAACCAGAAGGG + Intergenic
955257195 3:57344207-57344229 TTTGATTTGCATTTCCTGAAGGG - Intronic
956172686 3:66445023-66445045 TTTGGTTCCCAGATGCTAAAGGG - Intronic
958994837 3:100892365-100892387 TTTGGTACCCATATCCTATAAGG - Intronic
959116670 3:102186672-102186694 TTTGGTTACAATCACCTTAAAGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960260088 3:115557496-115557518 TTTTGTTACAACAGCCTGAAAGG - Intergenic
961837592 3:129676175-129676197 TTTTCTGACCATATCCTGAGGGG + Intronic
966624742 3:182003687-182003709 TTTGGTCACCACATTCTGGAAGG + Intergenic
967186901 3:186951760-186951782 TTTTGTTATCACAGCCTGAATGG - Intronic
968181708 3:196599873-196599895 TTTGGTTACTTTCTCCTCAAGGG + Intergenic
971392302 4:26197593-26197615 TTTGGTTTCCATTTCCTGGGAGG - Intronic
972969240 4:44551886-44551908 TTTTGTTACAGCATCCTGAACGG - Intergenic
975280062 4:72551563-72551585 TTGGATTACCATCTCCTGGATGG + Intronic
975559010 4:75692282-75692304 TCTGGTTACCAAATCCTGAGAGG - Intronic
977675650 4:99744027-99744049 TTTGGTTACCTAATCATGGAAGG - Intergenic
978733619 4:112060587-112060609 TTTGGTTTCCTTATTCTAAATGG - Intergenic
979133068 4:117073065-117073087 TTTAATTACCATTTGCTGAATGG + Intergenic
979402344 4:120264084-120264106 TTTGGCAAACATACCCTGAATGG + Intergenic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
982500156 4:156144195-156144217 TTTTGTTATCATAGCCTCAATGG - Intergenic
982652759 4:158108040-158108062 TTTGGTTGCCATAACATGAGTGG + Intergenic
982926370 4:161342126-161342148 TTTTGTCACCATCACCTGAATGG + Intergenic
982964506 4:161887559-161887581 TTTTGCTACAATATCCTTAATGG + Intronic
983520547 4:168703984-168704006 TTTGGTTACTGTAGCCTGCATGG - Intronic
983827556 4:172282575-172282597 TTTATTTACCACATCCTAAAAGG - Intronic
984168336 4:176330952-176330974 TTTGGTTTCTTTATTCTGAAAGG + Exonic
984456170 4:179972199-179972221 TTTGATTATCACATGCTGAAAGG + Intergenic
986373416 5:7105113-7105135 TTTAGTTACCATACACTGCAGGG - Intergenic
986417348 5:7542507-7542529 TTTGTTTAGCAAATCATGAAAGG - Intronic
986766889 5:10936292-10936314 ATTGGTTACCAGAGACTGAAGGG - Intergenic
988710398 5:33768691-33768713 TTTGGTTCAAATATCCTTAATGG + Intronic
989002850 5:36778835-36778857 TTTGGTTTCCATTCCTTGAAGGG + Intergenic
989792880 5:45428698-45428720 TTTGGTTTCCAAATGCTGCAGGG - Intronic
991129473 5:63105715-63105737 TTTGGTCTCCATTTTCTGAAAGG - Intergenic
991621352 5:68548615-68548637 TTTAAGTGCCATATCCTGAATGG + Intergenic
993086947 5:83374863-83374885 TTTGGCAGCCATATCCTGGAGGG - Intergenic
993915450 5:93739597-93739619 TTTGGTCACCATATACTAAATGG - Intronic
994046785 5:95319203-95319225 ATTGGTAACCAGATCCTAAAAGG - Intergenic
994285789 5:97964371-97964393 TTTTGTTACAGCATCCTGAATGG + Intergenic
995094364 5:108217785-108217807 GGTGGTTACCAGATGCTGAAGGG - Intronic
996816412 5:127578316-127578338 TTTTTTTATCATATCGTGAAAGG - Intergenic
998321704 5:141238175-141238197 TTTGTTTAACCTATCTTGAAGGG + Intergenic
998424455 5:142014568-142014590 TTTGTTTTCCAAATCCTGAGAGG + Intergenic
999824985 5:155265266-155265288 TTTGTGTACCATATCCTGCTTGG + Intergenic
1000298257 5:159931618-159931640 TTTGGTTACAGCAGCCTGAATGG - Intronic
1004064722 6:12232796-12232818 TTTGGTTACCTTATAATGAAAGG + Intergenic
1004722959 6:18284492-18284514 ATTTGTTTCCATATCCCGAAAGG + Intergenic
1010702806 6:79072271-79072293 GGTGGTTGACATATCCTGAATGG - Intronic
1011067911 6:83348590-83348612 TTTGGTTTCAAAATTCTGAAGGG + Intronic
1012784614 6:103607577-103607599 TTTGGCTACCACATCCTCTAGGG + Intergenic
1013285005 6:108673637-108673659 TTTAGCTACCAAATACTGAAGGG - Intronic
1013991314 6:116257500-116257522 TTTTGTTACAACAGCCTGAATGG - Intronic
1014055528 6:117010408-117010430 ATTGGTTACCATAGCCATAAAGG - Intergenic
1015399714 6:132775329-132775351 TTTTGTTATAGTATCCTGAATGG + Intronic
1017115410 6:150971514-150971536 TATGGTTACCTTTTCTTGAATGG + Intronic
1017155022 6:151315179-151315201 TTTTGTTACAACAGCCTGAACGG - Intronic
1018586388 6:165364481-165364503 TTTCGTTATAATAGCCTGAAGGG + Intronic
1018665328 6:166131175-166131197 TTTGGTTACCAAATTCCTAAGGG - Intergenic
1026061258 7:67028587-67028609 TTTTGTTATTATATTCTGAAAGG - Intronic
1026357125 7:69568121-69568143 CTTGGCTGTCATATCCTGAATGG + Intergenic
1026441946 7:70452631-70452653 TTTGGATCCCATTTCCTAAAAGG - Intronic
1026717094 7:72798799-72798821 TTTTGTTATTATATTCTGAAAGG + Intronic
1032830268 7:135617636-135617658 TATGGCTGCCATACCCTGAAGGG - Exonic
1036629215 8:10498744-10498766 CATGGTTACCATTTCATGAACGG - Intergenic
1045687297 8:104725556-104725578 TTTGGTTTTCAAATCCTGTAAGG - Intronic
1046312306 8:112453864-112453886 TTTGGTTACCGTAGCCTTATAGG - Intronic
1046504742 8:115123035-115123057 TCAGGTTACCAAACCCTGAATGG - Intergenic
1053703410 9:40725114-40725136 TTTGTCTAACACATCCTGAATGG + Intergenic
1054413467 9:64848576-64848598 TTTGTCTAACACATCCTGAATGG + Intergenic
1054754830 9:68947127-68947149 TGTGTTTTCCATTTCCTGAAAGG - Intronic
1055837095 9:80456344-80456366 TGTGAGTACCATAGCCTGAAGGG + Intergenic
1058007661 9:99935972-99935994 CTAAGTTACCATATCCTGCAAGG - Intronic
1186220875 X:7347946-7347968 CTTGGTTACCATCTCCAGCAGGG - Intronic
1186538930 X:10379949-10379971 TTTGGTTCCCAAGTCTTGAAAGG + Intergenic
1190642099 X:52490175-52490197 TTTGGATAACATTTCTTGAAAGG + Intergenic
1190645574 X:52522691-52522713 TTTGGATAACATTTCTTGAAAGG - Intergenic
1194207159 X:91025123-91025145 TTTGGTAATGATATCTTGAATGG + Intergenic
1198081950 X:133248486-133248508 TTTGCTTAGCAAATCCTGTAGGG - Intergenic
1199443137 X:147891183-147891205 TTTTGTTATCATATACTAAAAGG + Intergenic
1200071011 X:153529350-153529372 TTGGGTTTCCATATCCAGTAGGG + Intronic
1200552903 Y:4599882-4599904 TTTGGTAATGATATCTTGAATGG + Intergenic