ID: 1094459768

View in Genome Browser
Species Human (GRCh38)
Location 12:30682967-30682989
Sequence GCAGCTACTACTGGCACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094459768 Original CRISPR GCAGCTACTACTGGCACTAA AGG (reversed) Intronic
902810595 1:18885794-18885816 GCAGCCACTACAGGCTCTGATGG - Intronic
906000886 1:42423788-42423810 GCAGCTGCTGCTTTCACTAATGG + Intergenic
924925825 1:248679071-248679093 GCAGCTACTCCTGCCCCAAATGG + Intergenic
1071735320 10:88292374-88292396 ACAGCCACTATTTGCACTAAAGG + Intronic
1072127970 10:92464351-92464373 ACAGCTAGGACTGTCACTAAGGG - Intronic
1079886140 11:25991811-25991833 GCAGTTACTACAGTCACTGAAGG + Intergenic
1086198802 11:84174834-84174856 GCAGCTACTATTGCTACTACTGG + Intronic
1094459768 12:30682967-30682989 GCAGCTACTACTGGCACTAAAGG - Intronic
1094495324 12:30985697-30985719 GCAGCTTCTACAGGCTCTCAAGG - Intronic
1106760693 13:32864706-32864728 CTAGCCACTACTTGCACTAAAGG - Intergenic
1119015195 14:71044195-71044217 GCAGCCACTACTGGCACCTGAGG - Intronic
1130016926 15:80194827-80194849 ACAGATACTTCTGGCACTATTGG - Intergenic
1130421673 15:83754129-83754151 GGAGGTGCTACTGGCATTAATGG - Intronic
1134741315 16:16549457-16549479 GCAGCTGCTTCTGTCCCTAAGGG - Intergenic
1134926243 16:18162985-18163007 GCAGCTGCTTCTGTCCCTAAGGG + Intergenic
1147012724 17:37464507-37464529 GCAGGAACTGCTGGCAGTAATGG - Intronic
1150246898 17:63682847-63682869 ACAGGTTCTACTTGCACTAAAGG + Intronic
1156060116 18:33063665-33063687 GCTGCTACTGCTGGCACTCTAGG + Intronic
1158887989 18:61847048-61847070 GCAGCTACTATGTGCACTACTGG - Intronic
1163557338 19:18000210-18000232 GGAGCTACCACTGGCACAGAAGG - Intergenic
1165711697 19:38015820-38015842 GAAGCAACTCCTGGCTCTAATGG + Intronic
931396895 2:61895726-61895748 GCAGGCAGTACTGGCCCTAACGG - Intronic
932465928 2:71924079-71924101 GCAGCTGCTCTGGGCACTAATGG + Intergenic
936971504 2:118180749-118180771 GGAGTTATTACTGGGACTAAAGG + Intergenic
939039214 2:137167730-137167752 GCAGATACTAGTTTCACTAAAGG + Intronic
949069356 2:242014144-242014166 GCAGACACTGCAGGCACTAAAGG - Intergenic
1170444414 20:16410895-16410917 GCAGCCCCTACAGGAACTAAGGG - Intronic
1171253125 20:23665222-23665244 GCAGGTGCTACTGGCATTTAGGG + Intergenic
1171259615 20:23720535-23720557 GCAGGTGCTACTGGCATTTAGGG + Intergenic
1182818108 22:33186982-33187004 GCATCTATTTCTGACACTAATGG - Intronic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
953457610 3:43055368-43055390 GCAGCTACGGCTGGCACCTATGG - Intronic
953458626 3:43063534-43063556 CCAGGTACTACTGGCACTGCTGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
959663122 3:108891530-108891552 CCAGTTACTACTTGGACTAAAGG - Intergenic
960304279 3:116042283-116042305 GGAGCTATTAATGGTACTAATGG + Intronic
962886057 3:139628937-139628959 GCTGCTACTGCTGACCCTAATGG + Intronic
965417431 3:168414521-168414543 GCAGCTACTGCTGGCTCTTCTGG + Intergenic
967135329 3:186508288-186508310 GCAGCTACCACTGGCACACTGGG + Intergenic
967237387 3:187399164-187399186 GCAGCTCCTACTGCCTCCAAAGG + Intergenic
967823025 3:193855904-193855926 GCTTCTACTACTGGCAAAAAAGG - Intergenic
969872285 4:10112081-10112103 ACAGGGACTACTGGCACTACTGG + Intronic
969930570 4:10627194-10627216 GTAGCTACTCCTGGCCCTCAGGG - Intronic
982202745 4:152975438-152975460 GCTGCTGCTGCTGGCACTGAGGG - Exonic
983881168 4:172934928-172934950 GCAGCTATTACTGGCACCTATGG + Intronic
984710660 4:182881353-182881375 GCAGCTACTACTGTCTTTAAAGG - Intergenic
992842159 5:80706009-80706031 GCAACTACCACAGGCACAAACGG - Intronic
997270053 5:132528856-132528878 GCTTCTACTACTTGCACTGAAGG + Intergenic
998499056 5:142616101-142616123 ACAGCTGCTACAGGCACTGATGG - Intronic
1003413133 6:5883416-5883438 GCTGCTGCTGCTGCCACTAAAGG + Intergenic
1006853520 6:37116675-37116697 GCAGCTGCAACTGGCACAGAAGG + Intergenic
1006906432 6:37536557-37536579 GCAGCTCCTCCTGGCTCTTAAGG + Intergenic
1021785014 7:24142720-24142742 GGGGCTACTACTGGCATTTAGGG + Intergenic
1024702839 7:51923421-51923443 GCAGTCACTACTGTCTCTAAAGG + Intergenic
1033595821 7:142856960-142856982 GGTGCTACTCCTGGCACTCAGGG + Intronic
1038580326 8:28742955-28742977 GGAGGTATTACTGGCACTTAGGG - Intronic
1049373502 8:142278639-142278661 GCAGCTGCCACTGGCTCCAAGGG - Intronic
1050156178 9:2668321-2668343 GCATCTACTACAGGCACAAAAGG + Intergenic
1053030869 9:34777093-34777115 TCAGCTACTGCTGCCACCAATGG - Intergenic
1054799370 9:69331931-69331953 CCAGCTACTGCTGCCACCAAGGG + Intronic
1185727325 X:2432497-2432519 GGAGGTACTACAGGCATTAATGG + Intronic
1188468016 X:30504890-30504912 GCATCTGCTATGGGCACTAAAGG - Intergenic
1189492765 X:41482766-41482788 GCATCTACTACTGGCTCTCCTGG + Intergenic
1189630042 X:42943117-42943139 GCTGCTTCTACTGGCAAAAAAGG + Intergenic
1198096642 X:133386520-133386542 GCAGCTCCTAATGACATTAATGG + Intronic
1200057067 X:153467213-153467235 GCAGCCACTACTGGCCCTGGAGG - Intronic
1202191881 Y:22254014-22254036 GCAGCCACTACTGGGAGTACAGG - Intergenic