ID: 1094462564

View in Genome Browser
Species Human (GRCh38)
Location 12:30712935-30712957
Sequence CACCCTGTTGGTGGTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 3, 2: 11, 3: 57, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094462557_1094462564 12 Left 1094462557 12:30712900-30712922 CCGGCTAATTTTGATTTTTAGTA 0: 4
1: 111
2: 610
3: 1801
4: 4358
Right 1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG 0: 1
1: 3
2: 11
3: 57
4: 284
1094462555_1094462564 21 Left 1094462555 12:30712891-30712913 CCACCACGTCCGGCTAATTTTGA 0: 4
1: 188
2: 5625
3: 55892
4: 181382
Right 1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG 0: 1
1: 3
2: 11
3: 57
4: 284
1094462556_1094462564 18 Left 1094462556 12:30712894-30712916 CCACGTCCGGCTAATTTTGATTT 0: 1
1: 13
2: 641
3: 9406
4: 53178
Right 1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG 0: 1
1: 3
2: 11
3: 57
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094462564 Original CRISPR CACCCTGTTGGTGGTCAGGC TGG Intronic
901458930 1:9379998-9380020 CACTATGTTGTTGGCCAGGCTGG - Intergenic
902610894 1:17596617-17596639 CACCATGTGGGTGGTCGGGGAGG - Intronic
902996819 1:20232121-20232143 CACCATGTTGTTGGCCAGGTTGG - Intergenic
903213817 1:21832463-21832485 CCCCCTGTAGGTGGGGAGGCTGG + Intronic
903957079 1:27033039-27033061 GATCCTGATGGTGGCCAGGCGGG - Intergenic
906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG + Intronic
907717661 1:56942504-56942526 CGCCATGTTGTTGGCCAGGCTGG - Intronic
908472692 1:64459540-64459562 ACCCCTGAGGGTGGTCAGGCAGG + Intergenic
913317624 1:117566032-117566054 CTCCCTGCTGGGGCTCAGGCAGG + Intergenic
915069268 1:153252606-153252628 CAAGGTGTTGGTGGCCAGGCAGG + Intergenic
917752723 1:178068281-178068303 CACCCTGAGGGTGGTCATCCTGG + Intergenic
919859044 1:201726446-201726468 CATGTTGTTGTTGGTCAGGCTGG - Intronic
921311648 1:213850494-213850516 CCCCCTGTTTTGGGTCAGGCAGG + Intergenic
922883575 1:229001003-229001025 CACCATATTGGTGGCCAGGCTGG - Intergenic
1064048432 10:12040221-12040243 CACCATGTTGTTGGCCAGGATGG - Intronic
1064339510 10:14473746-14473768 CACTCTGTTGTTGCCCAGGCTGG - Intergenic
1065344149 10:24733082-24733104 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1065808418 10:29417786-29417808 CACCATGCTGCTGGCCAGGCTGG + Intergenic
1066410459 10:35163620-35163642 TACCATGTTGTTGGCCAGGCTGG - Intronic
1067663474 10:48254156-48254178 AACACTGTGGTTGGTCAGGCAGG - Intronic
1068994725 10:63190094-63190116 CACCATGTTGTTGGCCAGGCTGG + Intronic
1069724706 10:70569693-70569715 CACCCTGTTGGTGGTATTGTCGG + Intergenic
1071547511 10:86539623-86539645 CACCCAGTTGCTGGTGAGGCTGG - Intergenic
1072420026 10:95282742-95282764 CACCATGTTGGTGAACAGGCTGG - Intronic
1072590829 10:96827179-96827201 CTCACTGTTGAGGGTCAGGCAGG + Intergenic
1073409054 10:103324559-103324581 CACCATGTTGTTGGTCAGGCTGG - Intronic
1073564227 10:104521494-104521516 CACCATGTTGTTGGCCAGGCTGG + Intergenic
1073892802 10:108120457-108120479 CACCATGATGTTGGCCAGGCTGG + Intergenic
1075443996 10:122501146-122501168 CACCCTGTGGATGGGCAGGATGG - Intronic
1076547508 10:131255075-131255097 CACCCTGCTGGTGTTCTGCCCGG - Intronic
1076656229 10:132025523-132025545 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1076914848 10:133418200-133418222 CACCATATTGGTGAACAGGCTGG + Intronic
1079492531 11:21005401-21005423 CACCCTGTGGCTGTTCAGACTGG + Intronic
1079666652 11:23114282-23114304 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1080362547 11:31532969-31532991 CATCATGTTGGTGGTCAGGATGG + Intronic
1080779119 11:35414626-35414648 CAGCTTGTTGGGGGCCAGGCAGG - Intronic
1083027983 11:59566277-59566299 CACCCTGTGGGTTCTCACGCGGG - Intergenic
1083353533 11:62048107-62048129 CACCCTGTTGGAGGTGTTGCTGG - Intergenic
1083398607 11:62408693-62408715 CTCCCTGTTGTTGCCCAGGCTGG + Intronic
1083644362 11:64164185-64164207 CGCCCCCTAGGTGGTCAGGCTGG - Intronic
1084083509 11:66843973-66843995 CACCCTGATGGGCTTCAGGCTGG + Exonic
1084526504 11:69701767-69701789 CACCATGTTGGTGGCCAGGCTGG - Intronic
1084527977 11:69709149-69709171 CACCCTGTTAGTGGTGAAGTTGG + Intergenic
1084554803 11:69869270-69869292 CACCCAGGTGGTGGTAGGGCAGG - Intergenic
1086760941 11:90630067-90630089 CAGCCTGTTGTTGCCCAGGCTGG - Intergenic
1086775784 11:90831360-90831382 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1087483497 11:98732207-98732229 ACTCCTGTTGTTGGTCAGGCTGG + Intergenic
1088524952 11:110742513-110742535 GAGCCTGTTGGTTTTCAGGCTGG - Intergenic
1089547347 11:119238997-119239019 CACTCTGTTGTTGCCCAGGCTGG + Intronic
1090119953 11:124015700-124015722 CATCCTGCTGGTGATCAGGGTGG + Exonic
1090120598 11:124023138-124023160 CATCCTGCTGGTGATCAGGGTGG + Exonic
1090121167 11:124029748-124029770 CATCCTGCTGGTGATCAGGGTGG + Exonic
1090121914 11:124038854-124038876 CATCCTGCTGGTGATCAGGGTGG - Exonic
1091746500 12:2996186-2996208 CATCCTGTTGGAAGCCAGGCAGG - Intronic
1091870872 12:3890128-3890150 CACAGTGTTGGGGGTCAGGGAGG - Intergenic
1092160170 12:6311393-6311415 CTCCCTGTCTGTGGTCAGGAGGG + Intronic
1093079009 12:14788039-14788061 CATCATGTTGGTCATCAGGCTGG - Intronic
1094348783 12:29499750-29499772 CACCATGTTGGCCGCCAGGCTGG - Intergenic
1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG + Intronic
1094556541 12:31505862-31505884 CACTCTGTTGTTGTCCAGGCTGG + Intronic
1094610854 12:31994411-31994433 CACCATGTTGGTCGTCAGGATGG + Intergenic
1095140327 12:38654702-38654724 CATCCTGTTGGGATTCAGGCTGG - Intronic
1095427538 12:42093294-42093316 CACCACTTTGGTGGCCAGGCTGG + Intronic
1096882029 12:54680946-54680968 TACCCTTTTGTTGGCCAGGCTGG + Intergenic
1096992273 12:55814668-55814690 CACCATGTTATTGGTCCGGCTGG - Intronic
1097698825 12:62800364-62800386 CACGCTGTTGTTGCCCAGGCTGG + Intronic
1097737070 12:63194312-63194334 CACCATGTTGGTGGTGGGCCAGG + Intergenic
1097881452 12:64690378-64690400 CACCATGTTGGTGGCCAGGCTGG + Intronic
1098264229 12:68702458-68702480 CACTCTGTTGTTCGCCAGGCTGG + Intronic
1100189954 12:92179859-92179881 CACCCTGTTCTTGGAGAGGCAGG - Intergenic
1102040892 12:109800138-109800160 CACCATCTTGTTGGCCAGGCTGG + Intronic
1102101007 12:110279157-110279179 CACTCTGTTGTTGCTCAGGCTGG + Intergenic
1102487846 12:113270164-113270186 CACTCTGTTGTTGCCCAGGCTGG - Intronic
1102898235 12:116615703-116615725 CACTCTGTTGTTGTCCAGGCTGG + Intergenic
1103329271 12:120142629-120142651 CACCCAGCTGGTGGTGCGGCAGG - Exonic
1103633234 12:122280270-122280292 CACCATGTTGGTCACCAGGCTGG + Intronic
1103974401 12:124692872-124692894 CACTCTGGTGGTGGGCAGGTGGG + Intergenic
1104586585 12:130052820-130052842 CAGCCTGTCGGTGGCCAAGCTGG + Intergenic
1105561873 13:21499826-21499848 CACTGTGTTGTTGGCCAGGCTGG - Intronic
1106161597 13:27205697-27205719 CACCATGTTGTTGCACAGGCTGG - Intergenic
1107849016 13:44551448-44551470 CACTCTGTTGTTGCCCAGGCTGG + Intronic
1108201042 13:48043410-48043432 CACTCTGTCGCTGCTCAGGCTGG - Intronic
1108444946 13:50498741-50498763 CGCTCTGTTGCTGGACAGGCTGG - Intronic
1110058076 13:71003260-71003282 CACTATGTTGTTGGCCAGGCTGG - Intergenic
1111228954 13:85315535-85315557 CTCGCTGTTGTTGCTCAGGCTGG + Intergenic
1112503037 13:99956867-99956889 AACCCGGGTGGAGGTCAGGCTGG + Intergenic
1114266743 14:21076755-21076777 CACCCTGTAGAGGGTAAGGCAGG - Exonic
1114940442 14:27603705-27603727 GAGCCTGGTGGTGGTGAGGCGGG + Intergenic
1115208898 14:30944806-30944828 CACCATGTTGGTCAACAGGCTGG + Intronic
1115215289 14:31007995-31008017 AACCATGTTGTTGGCCAGGCTGG - Intronic
1115254005 14:31379141-31379163 CACCGTGTTGTTGGCCAGGCTGG + Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1118316963 14:64731395-64731417 CTCCCCGTAGGTGGTCAGGTCGG - Exonic
1118852448 14:69594319-69594341 CACTCTGTTGTTGCCCAGGCTGG - Intergenic
1119790747 14:77347598-77347620 CTCCATGTTGTTGGTCAGGCTGG + Intronic
1121628654 14:95406388-95406410 CACCCTTTGGGAGGTGAGGCGGG - Intergenic
1123628038 15:22241012-22241034 CACCCCTTTGCTGGCCAGGCAGG + Intergenic
1123687105 15:22806544-22806566 CTCCCTGTTGTTGCTGAGGCCGG + Intronic
1124163539 15:27296672-27296694 CACGGTGTTGGTGGTGATGCTGG + Intronic
1124651163 15:31474974-31474996 TACTCTGTTGTTGGCCAGGCTGG - Intergenic
1125532037 15:40419903-40419925 CACCATGTTGGTCGTCAGGCTGG - Intronic
1126736235 15:51734540-51734562 CACCCAGCTGGGTGTCAGGCAGG - Intronic
1126760030 15:51961420-51961442 CTCACTGTTGTTGCTCAGGCTGG + Intronic
1127480674 15:59373903-59373925 CACCGTGTTGGTGGCCAGGCTGG - Intronic
1127840278 15:62825652-62825674 AACCCAGCTGTTGGTCAGGCTGG - Intronic
1128150992 15:65363404-65363426 CACCCTCTTGGGGGTCCAGCAGG - Intronic
1128179429 15:65588467-65588489 CATCATGTTGTTGGTCAGGCTGG - Intronic
1129169489 15:73799000-73799022 CAGCCTGTTGGTGCTCAGAGGGG + Intergenic
1129968885 15:79759983-79760005 CACCCTGTGGATGCTCAGGATGG + Intergenic
1131462117 15:92624770-92624792 CTCCCTCTTGGTGGGGAGGCAGG + Intronic
1132145522 15:99426989-99427011 CACCCTGCAGCAGGTCAGGCTGG + Intergenic
1132825153 16:1901045-1901067 CACCATGTTGTTGGGCAGGCTGG - Intergenic
1133567080 16:7006182-7006204 CACTCTGTTTGTTGCCAGGCTGG + Intronic
1134667595 16:16030324-16030346 CACCATGTTGGTGAACAGGCTGG - Intronic
1134784374 16:16927929-16927951 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1135010328 16:18871738-18871760 CACCATGTTGTTGGCCAGGCTGG - Intronic
1135067017 16:19318556-19318578 CACCATGTTGGTGGCCAGGCCGG + Intronic
1135317181 16:21458901-21458923 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1135370101 16:21891144-21891166 CACCATGTCGTTGGCCAGGCTGG - Intergenic
1135441710 16:22479979-22480001 CACCATGTTGTTGGCCAGGCTGG + Intronic
1135763370 16:25155704-25155726 CACTCTGTTGTTGCTCAGGCTGG + Intronic
1136231216 16:28886650-28886672 CAGCTTGTTAGTGGTCAAGCTGG + Intronic
1136313995 16:29439056-29439078 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1136327434 16:29540821-29540843 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1136442124 16:30280819-30280841 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1136624872 16:31456266-31456288 CAGCCTCTAGTTGGTCAGGCTGG - Intergenic
1137354309 16:47744694-47744716 CAACCTCTTAGTGCTCAGGCGGG + Intergenic
1138738153 16:59277143-59277165 CTCCCTTTTGTTGCTCAGGCTGG + Intergenic
1139485759 16:67255754-67255776 CTCCCTGTTTGTGGTCAGTCTGG + Exonic
1139888931 16:70234549-70234571 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1141026285 16:80551833-80551855 AACTCTGTTGTTGCTCAGGCTGG - Intergenic
1141975912 16:87516322-87516344 CACCCCTTTGCTGGCCAGGCAGG - Intergenic
1142246077 16:88970650-88970672 CATCCTGCTGGTGCTGAGGCAGG - Intronic
1142247579 16:88976960-88976982 CACCCAGTTGGTGGCCGGGAGGG - Exonic
1143071144 17:4294714-4294736 CACCATGTTGTTGGCCAGGCAGG - Intronic
1143351680 17:6292578-6292600 CACACTGTTGGTGGGAATGCAGG - Intergenic
1143389748 17:6553246-6553268 CTCCCTGTTGCTGGTTAGACTGG + Intronic
1143561733 17:7700447-7700469 CACCATGATGTTGGCCAGGCTGG - Intronic
1144708037 17:17382889-17382911 CACCATGTTACAGGTCAGGCTGG + Intergenic
1144929548 17:18848315-18848337 CACCATGTTCGAGGCCAGGCTGG + Intronic
1145831503 17:27920124-27920146 CACTCTGTTGTTGCCCAGGCTGG - Intergenic
1145918948 17:28595846-28595868 CACCATGTTGGGGGTCAGGCTGG - Intronic
1146387673 17:32391856-32391878 CACCATGTTGTTGGCCAAGCTGG - Intergenic
1146783012 17:35693045-35693067 CACTCTGTTGTTGCCCAGGCTGG + Intronic
1146823271 17:36001490-36001512 CATCCTCCTGGTGGGCAGGCAGG + Exonic
1146825356 17:36017895-36017917 CATCCTCCTGGTGGGCAGGCAGG + Exonic
1147208450 17:38856176-38856198 CTCCAAGTTGGTCGTCAGGCTGG - Intergenic
1147374021 17:40013531-40013553 CACCATGTTGGTGGTCAGGCTGG - Intergenic
1147619616 17:41856819-41856841 CACCATGTTGTTGGCCAGCCTGG - Intronic
1147949790 17:44100719-44100741 CTCCCTGTTGTTGCCCAGGCTGG - Intronic
1149948292 17:60955579-60955601 CACCATGTTGGTGGCCAGGATGG + Intronic
1150432014 17:65126064-65126086 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1150795658 17:68234815-68234837 CACCATGTTGTTGGCCGGGCTGG - Intergenic
1152641537 17:81451454-81451476 CACTCCCTTGGTGGTAAGGCAGG - Intronic
1152912564 17:83013516-83013538 CACCCTGTGGGGGGTCGGGCAGG - Intronic
1153063093 18:1014191-1014213 CAGCCTCTTTGTGGTTAGGCAGG - Intergenic
1153640391 18:7151760-7151782 CTCCCTCTTGTTGGCCAGGCTGG - Intergenic
1154045781 18:10903468-10903490 CACCATGTTGTTGGCCAGGATGG - Intronic
1156453014 18:37277269-37277291 CACCCTGTTGGAGGGCCAGCTGG - Intronic
1157158746 18:45292693-45292715 AACCCTGTTGGTGGTGGGACCGG + Intronic
1157330416 18:46700022-46700044 CACCCAGATGGGGGTCATGCTGG - Intronic
1159034328 18:63262580-63262602 CACCCAGCTCATGGTCAGGCTGG + Intronic
1160614893 18:80118227-80118249 CACCATGTTGTTGGCCAGGCTGG - Intronic
1162923128 19:13915442-13915464 CACCATGTTGCTGCCCAGGCTGG + Intronic
1163658992 19:18565427-18565449 CACCGTGTTAGTAGTCAGGATGG + Intronic
1164072281 19:21779305-21779327 CACCATGTTGTTGGCCAGGCTGG - Intergenic
1164080269 19:21856294-21856316 CACTATGTTGTTGATCAGGCTGG - Intergenic
1165207456 19:34202683-34202705 CACTCTGTTGCTGCCCAGGCTGG + Intronic
1165388750 19:35526711-35526733 CACCATGCTGCTGGCCAGGCCGG - Exonic
1165819640 19:38666288-38666310 CACCCTGTTAGGGGAGAGGCTGG - Intronic
1166614701 19:44232864-44232886 CACCATGTTGTGGGCCAGGCTGG + Intronic
1167052528 19:47088348-47088370 CACCATGTTGGTGACCAGGGTGG - Intronic
1167309282 19:48727714-48727736 TACCCTGTTGTTGCCCAGGCTGG + Intronic
1168265526 19:55222020-55222042 CTCCATGTTGTTGGTCAGGCTGG + Intergenic
1168393527 19:56029758-56029780 GACCCTGTCTGTGGACAGGCTGG + Intronic
1168528059 19:57104450-57104472 CACCATGTTCGAGGCCAGGCTGG + Intergenic
1168622666 19:57891652-57891674 CACCCTGTTGTTAGCCAGGATGG - Intronic
1168639364 19:58020490-58020512 CACTATGTTGTTGGCCAGGCTGG - Intergenic
925349354 2:3190087-3190109 CACCCTGGGGGAGGCCAGGCAGG - Intronic
925862020 2:8187895-8187917 GACCCGGTTAGTGGTGAGGCTGG - Intergenic
927504262 2:23603039-23603061 CAGCCTGATGGTGGGCAGTCTGG + Intronic
928567987 2:32573166-32573188 AAACCTGTTGCTGGACAGGCTGG - Intronic
929198021 2:39206275-39206297 CACCATGTTGTTGTCCAGGCTGG + Intronic
930061409 2:47292190-47292212 CACCATATTGGTGAACAGGCTGG - Intergenic
930133640 2:47878780-47878802 CACCATGTTGTTGGCCAGGCTGG - Intronic
931729904 2:65144110-65144132 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
931733175 2:65171195-65171217 CTCCCTCTTGTTGCTCAGGCTGG + Intergenic
932068231 2:68589389-68589411 CGCCATGTTGGTGAACAGGCTGG - Intronic
932734110 2:74242275-74242297 CCAGCTGTTCGTGGTCAGGCAGG - Intronic
934589599 2:95534763-95534785 CACTATGTTGATGGCCAGGCTGG + Intergenic
934594216 2:95589850-95589872 CACTATGTTGATGGCCAGGCTGG - Intergenic
934788567 2:97035831-97035853 CACTATGTTGATGGCCAGGCTGG + Intergenic
935180170 2:100682097-100682119 CACCTTGGAGGTGGGCAGGCAGG + Intergenic
935513526 2:104005711-104005733 GACCCTGTTGATGGGCAGGCAGG + Intergenic
936275915 2:111097018-111097040 CAGCTTGATGGTGGTCAGGCAGG - Intronic
937405279 2:121622044-121622066 CAGCATGTTGTTGTTCAGGCTGG + Intronic
938766816 2:134465154-134465176 CACCATGTTGTTGCCCAGGCTGG - Intronic
940320672 2:152373038-152373060 CAACCTGTTAGTGTTAAGGCTGG - Intronic
942448292 2:176092715-176092737 TAACCTGTTGGAGGGCAGGCGGG + Intergenic
942657750 2:178231610-178231632 CACCCTGGTGGTGGTCAGGATGG - Intronic
942923196 2:181401681-181401703 CACCATGTTCGAGGCCAGGCTGG - Intergenic
943588541 2:189769132-189769154 CAACCTCATGTTGGTCAGGCTGG - Intergenic
944673629 2:202016730-202016752 CACCCTGTTGGTGGGAACACTGG - Intergenic
945302206 2:208225261-208225283 CACCATGTTGGTGAACAAGCTGG - Intergenic
947677854 2:232000760-232000782 CACCATGTTGTTGCCCAGGCTGG + Intronic
948642669 2:239385455-239385477 CTCCCTGTTGGTGGCCAGAGCGG + Intronic
1170280350 20:14639516-14639538 CACCCTGTCTGTGGCCAGACAGG + Intronic
1170437874 20:16349258-16349280 CACCCTGATGGTGGGCTAGCAGG - Intronic
1171355274 20:24539975-24539997 CACCATGATGTTGGCCAGGCTGG + Intronic
1173232875 20:41215056-41215078 CACCATGTTGTTGGCCAGGCTGG - Intronic
1173600673 20:44292748-44292770 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1173798016 20:45876238-45876260 CTCCATGTTGGTAGTCAGGCTGG + Intronic
1173894930 20:46543525-46543547 CACCATGTTGTTGGCCAGGCTGG + Intronic
1174321659 20:49746813-49746835 CACCATGTTTGTGAACAGGCTGG + Intergenic
1178412550 21:32377627-32377649 CACCCTGTATGTGGTCAGCCTGG - Intronic
1178743135 21:35222121-35222143 CATCCTGTAGCTGGTCATGCAGG + Intronic
1178852249 21:36222381-36222403 CACCGTGATGTTGGCCAGGCTGG - Intronic
1178971230 21:37178929-37178951 CACTCTGTTGTTGCCCAGGCTGG - Intronic
1179007885 21:37530890-37530912 CACCCTGTCGGCGCTCAAGCTGG + Intergenic
1179406860 21:41133212-41133234 CACCATGTTCTTGATCAGGCTGG - Intergenic
1180690805 22:17713943-17713965 CACCATGGTGTTGGCCAGGCTGG - Intronic
1180953690 22:19731863-19731885 CTCCCTGTTGGGGGTCAGCCGGG - Intergenic
1181408976 22:22704743-22704765 GACCCTGCTGATGGTCAGGGTGG - Intergenic
1181410194 22:22713118-22713140 GACCCTGCTGATGGTCAGGGTGG - Intergenic
1183675882 22:39298602-39298624 CACTGTGTTGGGGGTCAGGCAGG - Intergenic
1184371927 22:44088101-44088123 CACCTTGTCAGTGGTCAAGCTGG + Intronic
951758376 3:26117808-26117830 CTCCTGGTTGGTGGCCAGGCAGG - Intergenic
952365665 3:32672758-32672780 CACTATGTTGTTGGCCAGGCTGG - Intergenic
952901843 3:38116129-38116151 CGGCCTGTTTGTGGGCAGGCTGG - Intronic
954030039 3:47812691-47812713 CACTCTGTTGTTGCCCAGGCTGG + Intronic
954656489 3:52197387-52197409 CACCCTGCTGGTGCCCAGGGTGG + Intergenic
954664051 3:52241377-52241399 CACCATGTTGTTGTCCAGGCTGG - Intergenic
955226382 3:57063704-57063726 CACGCTGCTGGTAGTCAGGAAGG + Intronic
956728720 3:72177555-72177577 GTCCCTGTTGATGGTCAGGCTGG + Intergenic
959029619 3:101283050-101283072 CACTCTGTTGTTGCCCAGGCTGG + Intronic
959705366 3:109334349-109334371 CACTATGTTGTTGCTCAGGCTGG - Intronic
961351668 3:126308187-126308209 CACACTGCTGGAGGGCAGGCAGG + Intergenic
962325704 3:134430343-134430365 CACCCTGCTGGTGGACAGTGTGG + Intergenic
964835590 3:160934916-160934938 CACTCTGTTGTTGCCCAGGCTGG - Intronic
964870857 3:161312729-161312751 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
965028551 3:163333896-163333918 CTCCATATTGGTGGTCAGGCTGG - Intergenic
965816602 3:172643134-172643156 CTCCATGTTGTTGATCAGGCTGG + Intronic
966951379 3:184821544-184821566 CACCGTGTTGCTGCCCAGGCTGG + Intronic
967990929 3:195130221-195130243 CTACCTGTTGGTGGGCATGCTGG - Intronic
968130433 3:196189894-196189916 CACCCTGTTTCTGCTCAGGGGGG - Intergenic
968265035 3:197356217-197356239 CTCCCTCTTGTTGCTCAGGCTGG - Intergenic
968384197 4:122040-122062 CACCATGTTGTTGGCCAGGCTGG - Intergenic
968700573 4:2055659-2055681 CTCCCTGTTCTTGCTCAGGCTGG - Intergenic
969278380 4:6152394-6152416 CAGCCAGTTGGTGGTGGGGCTGG - Intronic
969519314 4:7666530-7666552 CACCTTGTTGGTGGTGAGGTGGG - Intronic
971310747 4:25523802-25523824 CACCATGTTGGTGAATAGGCTGG - Intergenic
973244929 4:48001268-48001290 CAACATGTTGGTGAACAGGCTGG - Intronic
975651906 4:76601700-76601722 CACTATGTTGGTGGCCAGGCTGG + Intronic
976118813 4:81757899-81757921 CACCCTGTTGGCAGTGAGCCTGG - Intronic
984861247 4:184241747-184241769 CACCATGTTGTTGTTCAGGCTGG + Intergenic
985696808 5:1345321-1345343 CCCCCACTTGGTGGTCTGGCAGG - Intergenic
986954354 5:13133004-13133026 CACCATGTTGGTGGCCAGGCTGG + Intergenic
989112237 5:37917445-37917467 CACCCTATTGATGGTGATGCAGG - Intergenic
989642257 5:43594057-43594079 CACTCTGTTGTTGCCCAGGCTGG - Intergenic
991225272 5:64263169-64263191 CACCTGGTTGGTGGTTAGTCTGG + Intronic
991446031 5:66700652-66700674 CACTCTGTTGTTGCCCAGGCTGG - Intronic
995318224 5:110800774-110800796 CCCAATGTTGGAGGTCAGGCTGG + Intergenic
997484589 5:134219484-134219506 TACCCTGCTGGTGTTGAGGCTGG - Intronic
998350449 5:141496988-141497010 CACCATGTTGGCTGCCAGGCTGG - Intronic
999211707 5:149895173-149895195 CTCCCTGCTGGTGGTATGGCGGG - Exonic
999325474 5:150640982-150641004 CAGCCTGTGAGTGGTGAGGCGGG + Intronic
1000047519 5:157533767-157533789 CACCGTGTTGTTGGCCAGGATGG - Intronic
1001208788 5:169790833-169790855 CAGCCTGGTGGTAGTAAGGCTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001689978 5:173625718-173625740 CAGCCTCTTGGAGCTCAGGCAGG - Intergenic
1002505469 5:179676495-179676517 CACCATGTTGGCGGCCAGGTTGG + Intergenic
1002634633 5:180600991-180601013 CACCCTGTTGGTGGACACCTGGG + Intergenic
1003536172 6:6977533-6977555 CACTCTGTTGCTGCTCAGGCTGG - Intergenic
1005396446 6:25386930-25386952 CACCATGTTGTTGGCCAGGCTGG - Intronic
1005509350 6:26498292-26498314 CAGCCTGTGGGTGGACAAGCAGG + Intergenic
1006102044 6:31691608-31691630 CACCATGTTTGTGGACCGGCGGG - Exonic
1006572577 6:35017820-35017842 CACCCTGGTGGTGCTGAGGAAGG + Exonic
1006760298 6:36454841-36454863 CACCATGTTGTTGGCCAGGCTGG + Intronic
1006800951 6:36759392-36759414 CTTCTTCTTGGTGGTCAGGCGGG + Intronic
1013076376 6:106775269-106775291 CACCATGTTGGTCACCAGGCTGG + Intergenic
1013502359 6:110765479-110765501 CACCATGTTGTTGGGCAGGATGG - Intronic
1015369281 6:132433025-132433047 CAGCCTGTTGTGTGTCAGGCAGG - Intergenic
1016805716 6:148210330-148210352 CCCCATGTTGTTAGTCAGGCTGG - Intergenic
1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG + Intergenic
1019124466 6:169829347-169829369 CACCCTGATGGGGGTGAGGGTGG + Intergenic
1019548303 7:1589208-1589230 TACCCTGCTGGTGGGCAGTCTGG + Intergenic
1019732069 7:2633972-2633994 CACCCTGCTGGAGGCCAGGCAGG - Intronic
1020956874 7:14750831-14750853 CACTCTGTTGTTGCCCAGGCTGG + Intronic
1021180882 7:17504407-17504429 CACCATGTTGTTGGTCAAGCTGG + Intergenic
1021257847 7:18416096-18416118 CACCATGATGATGGTCAGGCTGG - Intronic
1022060400 7:26787520-26787542 CACCATGTTAGTGGCCAGGCTGG + Intronic
1022240828 7:28511196-28511218 CATGCTGCGGGTGGTCAGGCAGG + Intronic
1022652820 7:32292997-32293019 CACTCTGTGGGTGGGCAGCCAGG - Intronic
1024243697 7:47454176-47454198 CCCCCTGTTTGTGTTCAGCCTGG - Intronic
1024267879 7:47620708-47620730 CACTCTGTTGCTGCCCAGGCTGG + Intergenic
1024292869 7:47818107-47818129 CACCCTCTGGGTGCTCTGGCAGG - Exonic
1026015349 7:66667276-66667298 GTCCCTGTTGGTGGGCAGGCAGG + Intronic
1026174366 7:67982990-67983012 CACCATGTTGTTGGCCAGGCTGG + Intergenic
1026891758 7:73986428-73986450 GTCCCTGTTGGCGGGCAGGCGGG + Intergenic
1030170570 7:106598790-106598812 CACCCTTTTGGTGGTGAGTGGGG - Intergenic
1032293547 7:130613258-130613280 CACACTGCTGCTGGTCTGGCAGG + Intronic
1033187928 7:139246333-139246355 CACTCTGTTGCCGCTCAGGCTGG - Intronic
1034607724 7:152332648-152332670 CACCATGTTGTTGGTCAGGCTGG - Intronic
1034969349 7:155409429-155409451 CTGCCTGTTGGTGGCCACGCAGG - Intergenic
1034979421 7:155466751-155466773 CGCCCTCTTGGTGGTCAGGCTGG - Intergenic
1035690628 8:1557333-1557355 GACCCTGAGGGAGGTCAGGCAGG - Intronic
1035756904 8:2041460-2041482 CACCATATTGGTGAACAGGCTGG - Intergenic
1036204202 8:6793503-6793525 CACCATGCTGTTGGCCAGGCTGG - Intergenic
1037293069 8:17371664-17371686 TAAGCTGTTGGTGGTCGGGCAGG + Intronic
1037454852 8:19052974-19052996 CACACTGTGGAAGGTCAGGCAGG + Intronic
1037862172 8:22413179-22413201 CTCCCTGTGGGTGGTCTCGCAGG + Intronic
1037883442 8:22584207-22584229 CACCTTGTTGATGACCAGGCTGG + Intronic
1039887767 8:41664987-41665009 CACCCAGCTGTTGGTCACGCTGG - Intronic
1043416741 8:80058766-80058788 CACTCTGTTGTTGCCCAGGCTGG - Intronic
1043972820 8:86551404-86551426 CACCAGGTTGGTGGTTAGGGTGG + Intronic
1044444775 8:92262850-92262872 CACTCTGTTGCTGACCAGGCTGG - Intergenic
1045001461 8:97881949-97881971 CACTCTGTTGTTGCCCAGGCTGG + Intronic
1046107865 8:109688518-109688540 CACCCTGATGTTGGTGAGGGTGG + Intronic
1047785559 8:128150940-128150962 CACCCAATTGGTTGTCAGGAAGG + Intergenic
1048072739 8:131039631-131039653 CGCCCTGGTGGTGGTCAGGAAGG - Exonic
1048664175 8:136642589-136642611 CACCATGTTGTTGGCTAGGCTGG + Intergenic
1049667183 8:143850793-143850815 CACCATGTTGGATGTCAGTCAGG + Intergenic
1049734919 8:144199754-144199776 CTCCCTGGAGCTGGTCAGGCAGG + Intronic
1049778163 8:144415807-144415829 CACCATCTTGGGGGTCTGGCCGG + Exonic
1049811504 8:144576132-144576154 CACCATGTTGGTGGCTGGGCTGG - Intronic
1051622053 9:19060964-19060986 CTCCATGTTGTTGGTCAGGCTGG - Intronic
1051627669 9:19113802-19113824 CGCCCTGTCGCTGGACAGGCTGG + Intronic
1053506465 9:38647758-38647780 CACCATGTTGGTGAACAGGCTGG + Intergenic
1055168311 9:73223629-73223651 GACTGTGTGGGTGGTCAGGCTGG - Intergenic
1056379580 9:86045171-86045193 AACCCTGTCATTGGTCAGGCTGG - Intronic
1057726487 9:97572154-97572176 CACCCTGTGGGTGGGAAGTCAGG - Intronic
1058406732 9:104684850-104684872 CACCCTCTTGTTGCCCAGGCTGG - Intergenic
1058919020 9:109595536-109595558 CACCATGATGTTGGCCAGGCTGG - Intergenic
1059764200 9:117368034-117368056 CACTTTTCTGGTGGTCAGGCTGG - Intronic
1060342267 9:122788185-122788207 CACCATGTTGGTGGTCAGGCTGG - Intergenic
1060469101 9:123932523-123932545 CACCATGTTGGTGGTCAGGCTGG - Intergenic
1061254518 9:129446575-129446597 CACTCTGTCGTTGCTCAGGCTGG - Intergenic
1061465556 9:130776631-130776653 CTGCCTGTTGGTGGACAGGCTGG + Intronic
1061706440 9:132456938-132456960 CACCAAGTTGTTGCTCAGGCTGG + Intronic
1185672596 X:1824638-1824660 CCCAGTGTTGGTGGTGAGGCTGG - Intergenic
1185672822 X:1825739-1825761 CCCAGTGTTGGTGGTGAGGCTGG - Intergenic
1185673023 X:1826664-1826686 CCCAGTGTTGGTGGTGAGGCTGG - Intergenic
1185765448 X:2722517-2722539 CACCATGTTGATGAACAGGCCGG + Intronic
1186511050 X:10130059-10130081 CACCCATTTGCTGCTCAGGCAGG + Exonic
1188208837 X:27394216-27394238 CACTCTGTTGTTGCCCAGGCTGG + Intergenic
1188924241 X:36019629-36019651 CACCATGTTGGGGTTCAGTCAGG - Intergenic
1189640688 X:43067768-43067790 CACTCTCTTGGTGGTCCAGCTGG - Intergenic
1189756600 X:44278343-44278365 CACTCTGTCGTTGCTCAGGCTGG - Intronic
1190003478 X:46711786-46711808 CACCCTCTTGGTGGTAGAGCAGG - Intronic
1190884299 X:54517874-54517896 CACCCAGTTGGTGGCTTGGCTGG + Intergenic
1191887485 X:65903661-65903683 CAACTTGTTGGAGGTCAGTCAGG + Intergenic
1192246808 X:69379564-69379586 CATCCTCATGGTAGTCAGGCAGG - Intergenic
1192366470 X:70477849-70477871 CACCCAGTTGAAGGTCAGTCTGG + Intronic
1192408131 X:70908047-70908069 TACCCTGTTATTGGTCTGGCTGG + Intronic
1197886040 X:131219528-131219550 AACTCTGTGGGTGGTCAGGAAGG + Intergenic
1200793146 Y:7317245-7317267 CACTCTGTTGTTGCACAGGCTGG - Intergenic