ID: 1094463116

View in Genome Browser
Species Human (GRCh38)
Location 12:30719620-30719642
Sequence TTAAAGACTTATTAGTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094463116 Original CRISPR TTAAAGACTTATTAGTTAGT AGG Intronic
906362279 1:45173304-45173326 TTAAAGAGAAATTATTTAGTTGG - Intronic
907099813 1:51820066-51820088 GTAAAGACTTTTGAGTTATTGGG - Intronic
909834891 1:80241531-80241553 TTAAAGGATAATTAGATAGTGGG + Intergenic
910231666 1:84993924-84993946 TTCAAGACTTATTATTTGGCCGG - Intronic
910348652 1:86270535-86270557 CTAAAGTCTTATTATCTAGTTGG - Intergenic
910964268 1:92792515-92792537 TTATACACTTGTTAGGTAGTAGG + Intergenic
911126972 1:94349609-94349631 TAGAAGACTTATTAGTTAGAAGG - Intergenic
911333817 1:96556769-96556791 ATAAAGACTTATTGATTAGTGGG - Intergenic
912102850 1:106233273-106233295 TTAAAGACTGATTAAACAGTTGG + Intergenic
913344083 1:117790597-117790619 ATAAAGAGTTATTATTTAATGGG - Intergenic
914700168 1:150124964-150124986 TTAAAGACTTTTTAGTAACATGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
918162267 1:181912322-181912344 TTAAAAACATATCAGTTACTGGG + Intergenic
918653957 1:187000898-187000920 TTCAAGAACTATTATTTAGTAGG - Intergenic
918796613 1:188906301-188906323 AAAAAGATTTATTAGTTAATTGG - Intergenic
918923235 1:190743708-190743730 TTAAAGACTTCTGACTTTGTAGG + Intergenic
919532780 1:198745626-198745648 TTAAAGAGGAATTAGTCAGTTGG + Intronic
919703214 1:200652588-200652610 TTAAAGACATGTTAGAAAGTGGG - Intronic
919996923 1:202760829-202760851 TTAAAGACCTAGTTTTTAGTAGG + Intronic
920894198 1:210028042-210028064 ATAAAGACTTATTTTTTAATGGG - Intronic
923739017 1:236638655-236638677 TAAAAGAATTATAAGCTAGTAGG - Intergenic
1063591108 10:7396354-7396376 TTTAAGACTTTTCTGTTAGTTGG + Intronic
1066209199 10:33220409-33220431 TTAATTACTTTTTAGTGAGTGGG + Intronic
1068297359 10:55090229-55090251 TTAAATTTTTATTAGTTACTGGG + Intronic
1069122808 10:64588863-64588885 TTTATGATTTGTTAGTTAGTGGG - Intergenic
1069241432 10:66145124-66145146 ATAAATACTTAGTAGTTTGTAGG - Intronic
1070221476 10:74450831-74450853 TTAAAGATTTATTAGATAAATGG + Intronic
1070636114 10:78129231-78129253 TCAAAGACTTAGTACTTAGGGGG - Intergenic
1072182889 10:93005456-93005478 TTAAATACTTATTATATATTGGG + Intronic
1073727183 10:106247007-106247029 TTAAATACTTAATAATTGGTAGG - Intergenic
1078977066 11:16490044-16490066 TTGAACACTTATTACTTTGTGGG - Intronic
1080047560 11:27825379-27825401 TTATCCACTTATTAGTCAGTGGG + Intergenic
1081247695 11:40789123-40789145 TTATAAACTTATGTGTTAGTGGG + Intronic
1081284691 11:41253373-41253395 TTAAATACTTAATAGTTAACTGG - Intronic
1085833658 11:79929848-79929870 TAAAAGCCTTATTAGTCACTGGG - Intergenic
1086800415 11:91167443-91167465 TCAAAGAGTTATAATTTAGTTGG + Intergenic
1087605350 11:100370600-100370622 TTAAAGAGTTACTAGTTACTAGG - Intergenic
1087691421 11:101325180-101325202 ATATATACTTATTATTTAGTTGG + Intergenic
1091015469 11:132047347-132047369 TGAAAGACTATTTAGTTAATAGG - Intronic
1092946333 12:13457577-13457599 TTAAAGAGTAATCAGTTAATGGG - Intergenic
1093555561 12:20469469-20469491 TCAAAGACTCATTAGAGAGTGGG - Intronic
1094463116 12:30719620-30719642 TTAAAGACTTATTAGTTAGTAGG + Intronic
1095333956 12:41004541-41004563 TTAAAGACTCATTATTATGTGGG + Intronic
1097513715 12:60576268-60576290 TTAAAGCATTCTTAGTTTGTAGG + Intergenic
1099100918 12:78439507-78439529 CCAAAGACTCTTTAGTTAGTAGG + Intergenic
1099312146 12:81040158-81040180 TGAAATACTTATTATTTTGTTGG + Intronic
1099865617 12:88276867-88276889 TTGAAGAGTTATAAGTTAGGAGG + Intergenic
1100925311 12:99539468-99539490 TTTAAGAGTTATTTTTTAGTTGG - Intronic
1101719234 12:107336660-107336682 GTAAAGACTGATAGGTTAGTGGG - Intronic
1102032852 12:109753040-109753062 TCAAATATTTATTAATTAGTGGG - Intronic
1106725485 13:32480452-32480474 TCAAGCACTTACTAGTTAGTTGG + Intronic
1107911337 13:45108379-45108401 TAAAAAAATTATTAGTTACTTGG - Intergenic
1109356211 13:61232134-61232156 TTAATGACATATTAATTATTTGG - Intergenic
1110307096 13:74000792-74000814 TTAAAGACTTATTTGTTCTCTGG - Intronic
1112203288 13:97299729-97299751 TTCAAAACGTATTACTTAGTAGG + Intronic
1112217274 13:97445996-97446018 TTCAGGACTCATTACTTAGTAGG - Intronic
1112591760 13:100769811-100769833 TTAAAGAATGTTCAGTTAGTTGG - Intergenic
1112722587 13:102261428-102261450 TTAAAGAATTATAAATTAGCTGG + Intronic
1113292197 13:108919370-108919392 TTAAAGATTTTTGAGTTAGGAGG - Intronic
1116248084 14:42444067-42444089 TTACACACTGATTATTTAGTAGG + Intergenic
1117177605 14:53161001-53161023 TCAAAGACATATTATTTATTAGG + Intergenic
1117508446 14:56425241-56425263 TTAAAGAGTTACTAGTTGGCAGG - Intergenic
1117916907 14:60687396-60687418 TTACAGACTTTCTAGTCAGTTGG - Intergenic
1118061659 14:62145392-62145414 TTTAAGAGTTTTTAGGTAGTGGG + Intergenic
1118414359 14:65518382-65518404 GTAAAGACTCATTACTTTGTAGG + Intronic
1118425650 14:65658212-65658234 TTAAAAAATCATTAGTTATTAGG + Intronic
1118557906 14:67046644-67046666 TGAAAGAATTATTATTTACTAGG - Intronic
1119464254 14:74842092-74842114 TTAAACACTTACTACTTGGTTGG + Intronic
1120028189 14:79609590-79609612 ATAAAGACTGATTATTTACTAGG + Intronic
1122030879 14:98910851-98910873 TTAAAATCCTCTTAGTTAGTTGG - Intergenic
1128158196 15:65405110-65405132 TTCAAAATATATTAGTTAGTGGG + Intronic
1128827966 15:70738413-70738435 TTGATGACTTACTAGTTATTAGG - Intronic
1128985488 15:72217608-72217630 TTAAAGACTTTTGAGCTATTTGG - Intronic
1130776341 15:86987888-86987910 TTAAAAACATATTATTGAGTGGG - Intronic
1135024048 16:18985657-18985679 TAGAAGACTTTTTAGTTAGAGGG - Intronic
1137478165 16:48828808-48828830 TTAAAGACTTATTGCATAGCTGG + Intergenic
1138757128 16:59501774-59501796 TTAAAAACTTGTTATTTAATAGG + Intergenic
1139946166 16:70643812-70643834 TTAAAGAGTTATTAATTTGAGGG + Intronic
1144390645 17:14790515-14790537 TTAAAGACTTTAGAGTTACTAGG + Intergenic
1149374157 17:56027349-56027371 TCAAACACTTATTAGTTACATGG + Intergenic
1153495922 18:5699714-5699736 CCAAATACTTACTAGTTAGTGGG - Intergenic
1155133992 18:22968967-22968989 TTTAAGACCTATTAGTAAATTGG + Intronic
1155360198 18:24991980-24992002 TCAAACACTTTTTGGTTAGTAGG - Intergenic
1155668393 18:28338487-28338509 TCAAAGATTTATTTCTTAGTAGG + Intergenic
1156047693 18:32896152-32896174 TTAAAGAAATATTAGTAATTTGG - Intergenic
1156645341 18:39155452-39155474 TTATAGAAGTATTAGTTAATAGG + Intergenic
1157185343 18:45535804-45535826 ATAAAGACTGTTTAGTAAGTAGG - Intronic
1158211298 18:55053534-55053556 TTAAAAACTAATTAATTAATAGG + Intergenic
1159226125 18:65538380-65538402 TTAAAGACTTAATAGTGTTTGGG + Intergenic
1159517781 18:69479968-69479990 TTCAAAACTTATTAGTAAATTGG + Intronic
1161779684 19:6283330-6283352 TCAAACATTTATTAGCTAGTGGG + Intergenic
1162589290 19:11579959-11579981 TTAAAAACTTATTATTTAGCCGG + Intronic
925653217 2:6114798-6114820 TTAATGACTGATTAGCTATTTGG + Intergenic
926496423 2:13593873-13593895 TTAAAGGCCTATTAATTGGTTGG - Intergenic
926640833 2:15234940-15234962 TTTACCATTTATTAGTTAGTGGG + Intronic
927160353 2:20252659-20252681 TTAAAGAATTATTAGATTCTAGG + Intronic
929112460 2:38416622-38416644 TTGAAGAGTAATTAGTTTGTTGG + Intergenic
929915677 2:46133505-46133527 TTATAGAATTATTACATAGTAGG + Intronic
930415700 2:51088392-51088414 TTAAAGAGTTATTAATTCATGGG - Intergenic
931137475 2:59420083-59420105 TTAAATTCTTAATATTTAGTGGG - Intergenic
932356963 2:71074973-71074995 TTAAAGATGTATAAGTTTGTTGG + Intronic
933637201 2:84721203-84721225 ATAAAGAATTATTTGTTAGTGGG + Intronic
935209275 2:100924499-100924521 TTAAACACATATTACTAAGTTGG - Intronic
936890887 2:117368362-117368384 TTATCCACTTATTAGTTAATGGG - Intergenic
937730809 2:125226286-125226308 TTAATTACTTATTAGTTATCTGG - Intergenic
939432219 2:142125578-142125600 TTTAAAACTTATTAGTTTTTTGG - Intronic
939751582 2:146054011-146054033 TTATAGGCTTATTAGTAAGCTGG + Intergenic
940647012 2:156402328-156402350 TTAAGGACTTCTTAGTGTGTGGG + Intergenic
942801755 2:179883659-179883681 TCAAAGGCTTATTACTTAGAGGG + Intergenic
942895902 2:181053971-181053993 TTAAATGCATATTAGTAAGTGGG - Intronic
942898107 2:181082765-181082787 ATAAATACTTAGTAGTTATTTGG + Intergenic
943570466 2:189567858-189567880 TTGGAAACTTATTAGTTAGTGGG - Intronic
944049659 2:195453278-195453300 TGAATGACCTATTAATTAGTTGG - Intergenic
944176942 2:196840789-196840811 TTAAAGACTTATTTCTTAATAGG + Exonic
944697571 2:202216482-202216504 TTTAAGAATTATTAATTTGTGGG - Intronic
945294294 2:208155589-208155611 ATAATGACTTATTAATTAATTGG + Intergenic
947171337 2:227315313-227315335 TTAAAAACTTAATACATAGTGGG + Intergenic
947551339 2:231048915-231048937 TTAAAGTTTTCTTATTTAGTGGG + Exonic
948798280 2:240418161-240418183 TTATAGAATTATAAGTTTGTTGG - Intergenic
1169735903 20:8837319-8837341 TTAAATACTTAATACTTATTTGG - Intronic
1169848325 20:10021357-10021379 TTAAATATTTATTAATTAGGAGG + Intronic
1171151799 20:22834246-22834268 TTAAAGACTTTTTAAATAATAGG - Intergenic
1173517155 20:43672800-43672822 TTTAAGAGATATTAGTTATTTGG - Intronic
1173603387 20:44311690-44311712 TTATTTATTTATTAGTTAGTTGG + Intergenic
1176687200 21:9860739-9860761 GAAAAGTCTTATTAGTTAGTTGG - Intergenic
1176940910 21:14924533-14924555 TTAAAGAGTAATTAGTTGGAAGG + Intergenic
1178154725 21:29838432-29838454 TGAAACAGTTATTAGTAAGTGGG + Intronic
1179381242 21:40901245-40901267 TGAAAGAATTGTTAGTTAGCTGG - Intergenic
1182153978 22:28051698-28051720 TTAAATGGTTATTAGCTAGTGGG + Intronic
949463254 3:4317052-4317074 TTAAAGACGTGGTAGTTGGTTGG - Exonic
951389092 3:22081064-22081086 TTAAAAATTTATAATTTAGTTGG - Intronic
952007070 3:28854268-28854290 TAAAATACTCATTAGTAAGTTGG - Intergenic
955610114 3:60748146-60748168 TGAAAGCCTTATTAGAGAGTGGG + Intronic
955700162 3:61674336-61674358 TTAAAGCCATATTGGTTAGCAGG + Intronic
956061378 3:65351474-65351496 ATAAAGACTTTTCAGTTAGGTGG + Intergenic
956252023 3:67244452-67244474 TCATAGACTTAATAGTTATTTGG - Intergenic
957616083 3:82529197-82529219 TTAAATGCTTCTTAGTTTGTTGG + Intergenic
957657511 3:83099815-83099837 GTAAGGAATTAGTAGTTAGTTGG - Intergenic
958621310 3:96566181-96566203 TTAATGCCTTATTAAATAGTTGG + Intergenic
959150680 3:102603592-102603614 TCTCAGACTTATTTGTTAGTCGG - Intergenic
959152009 3:102618969-102618991 TCAAAGACTTATTACTCACTTGG + Intergenic
959243824 3:103836713-103836735 ATAAAGACTGATTGGTTAATGGG + Intergenic
959775047 3:110148900-110148922 TTAATATCTTATTATTTAGTGGG - Intergenic
960176885 3:114527780-114527802 TAAGAGACTTATTATTTAATAGG + Intronic
960851677 3:122061253-122061275 ATAAAGATTTATTGTTTAGTTGG - Intronic
963640501 3:147856039-147856061 TAAAAGACATATTAGTGTGTTGG - Intergenic
963647303 3:147930864-147930886 TTAAATAATTATCAATTAGTTGG + Intergenic
964251359 3:154721661-154721683 TTAAAGATTTAGTATTTAGAAGG - Intergenic
964728078 3:159835919-159835941 TTAAAGACACAATAGTTTGTAGG + Intronic
965585661 3:170315682-170315704 TTAAACACTTATTAATTGTTTGG - Intergenic
965742332 3:171889053-171889075 TTTAATATTTATTAGTTACTGGG + Intronic
971442323 4:26700654-26700676 CTCAAGAGTTATTAGTTAGTGGG + Intronic
971850839 4:31984837-31984859 TTAATCAGTTATTAGTGAGTTGG + Intergenic
972198362 4:36681632-36681654 TCAAACACTTATTATTTATTTGG + Intergenic
972395379 4:38654928-38654950 TTAAAGACTGCTTGGATAGTTGG - Intergenic
972980448 4:44693837-44693859 TTAAACACTTATTATGTACTAGG + Intronic
976503469 4:85818417-85818439 TTATAGACTGATGACTTAGTGGG - Intronic
976515346 4:85958017-85958039 TGAAAAACTTATTGGTTAATTGG - Intronic
976871125 4:89795260-89795282 TTAATCAATTATTATTTAGTGGG - Intronic
977226527 4:94398483-94398505 TAAAAGACTTGGTAGTTACTGGG - Intergenic
977487474 4:97666426-97666448 TTAAAGAAGTATTATTTATTAGG - Intronic
978008677 4:103651781-103651803 TCAAAGGCTTTTTAGTCAGTCGG + Intronic
978141277 4:105319961-105319983 GTAAAGAGTTATTGCTTAGTGGG + Intergenic
981442806 4:144802168-144802190 TTAACCACTTATTAGTTGTTGGG + Intergenic
981866684 4:149429344-149429366 TTAAAGACTTGTTTTTTACTTGG + Intergenic
981947142 4:150361248-150361270 TTAAATAATGATTAGTTAATAGG + Intronic
981976848 4:150740897-150740919 TAAAAGACTTATAAGTAAGATGG + Intronic
983398129 4:167229207-167229229 TTAAAGATTTATTTGTAATTTGG - Intronic
983760350 4:171397570-171397592 TAAAAGACATTTGAGTTAGTTGG - Intergenic
984290466 4:177787821-177787843 TTAAAGTGATATTACTTAGTTGG + Intronic
984670562 4:182481419-182481441 TTAAAGATTCATTATTCAGTAGG + Intronic
987615580 5:20269744-20269766 TTGAAGACAAATTAGTTAATGGG + Intronic
990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG + Intronic
996807112 5:127468343-127468365 TTAAAAATTTTTTAGTGAGTTGG - Intergenic
998345075 5:141455138-141455160 TTAAATAAATATTAGTTTGTTGG + Intronic
998422579 5:142001230-142001252 TTACATACTCATTAGTAAGTGGG - Exonic
999469570 5:151840743-151840765 TTAAAGACTGGTTTGTTTGTGGG - Intronic
999983498 5:156980607-156980629 TTAGAGAGTTACTAGTTACTAGG + Intergenic
1000239266 5:159394332-159394354 TTAAAGACTTATAAATTTCTTGG - Intergenic
1001148516 5:169205557-169205579 ATAAATACTTGTTGGTTAGTTGG + Intronic
1003356839 6:5381454-5381476 TTATAGGCTTATTAGTTAAAGGG + Intronic
1007343732 6:41210487-41210509 TTAAAGACTTTTTAATTTGGGGG + Intergenic
1009420050 6:63455456-63455478 TTAAAAACTCATTTGTGAGTGGG + Intergenic
1009732317 6:67623450-67623472 ATAAAGACTTATTAGAGACTGGG - Intergenic
1009863077 6:69360756-69360778 TTAAAGATATATTATTTGGTAGG - Intronic
1010509239 6:76697537-76697559 TTAAAGAGTTATCAGCTATTGGG + Intergenic
1010687138 6:78866532-78866554 GTAAAGACGTATAAGTCAGTGGG + Intergenic
1011682630 6:89797878-89797900 CTAAAGATTTATTAGAAAGTCGG + Intronic
1012159505 6:95865751-95865773 GTAAAAACTTATGATTTAGTTGG - Intergenic
1013840802 6:114391030-114391052 TTGAAGACTTATTATTAACTGGG + Intergenic
1015380046 6:132556663-132556685 TTAACCACTTGTTAGTCAGTGGG + Intergenic
1016097655 6:140058335-140058357 TTAAAGACTGATGAGTTGGAAGG - Intergenic
1016320728 6:142842818-142842840 TTAAAGAGATATTAGTGATTAGG + Intronic
1017895074 6:158672596-158672618 TTTAAAACTTTTTATTTAGTTGG + Intronic
1018022867 6:159778376-159778398 TTAAAGAAATACTAGTTACTAGG + Intronic
1020370415 7:7425967-7425989 TTAAAGCCTCATTAGTGTGTGGG - Intronic
1020673015 7:11142863-11142885 TTAATGACTTAATGGTTAATTGG + Intronic
1021623349 7:22569400-22569422 TTAAAGAATTATTAGGGACTAGG - Intronic
1022881925 7:34596721-34596743 TTAAAGACTGATTGATTAGATGG - Intergenic
1023396456 7:39756168-39756190 TTAAAAACTTAATTGTTGGTGGG + Intergenic
1024421797 7:49176148-49176170 TCAAACAATTATTAGTTAGTGGG - Intergenic
1024681872 7:51698824-51698846 TTTAAGACTGATGAGTTGGTAGG + Intergenic
1025225152 7:57152108-57152130 TTAAATACTTATTAATTAAAAGG + Intergenic
1026472378 7:70704888-70704910 TTAAATAATTGTTAGTTAATTGG - Intronic
1027212354 7:76160763-76160785 TTAACGATTTATTGGTTGGTTGG - Intergenic
1027449025 7:78308434-78308456 TAAAAGGCTTCTTATTTAGTAGG + Intronic
1031449575 7:121897869-121897891 TTGATGACTTATTACTTATTTGG + Intronic
1031881279 7:127201445-127201467 TTAAAGACTTGTTAGGAAGAAGG - Intronic
1033818427 7:145103565-145103587 TTTAAGATTTGTTAGGTAGTGGG - Intergenic
1033864502 7:145672393-145672415 TTCAAGACTTACTATTTAGCAGG + Intergenic
1033912436 7:146281307-146281329 TAAAAGGTTTATTATTTAGTAGG - Intronic
1035924689 8:3714768-3714790 TTAATGGCTTATTGGTTATTTGG + Intronic
1036055488 8:5248458-5248480 TTGATGACTTATAAGTAAGTTGG - Intergenic
1036077485 8:5517525-5517547 TCAAACACTTATTAATTGGTAGG - Intergenic
1037063485 8:14545761-14545783 TTAGAGACTTGTTAGTTGATAGG - Intronic
1037279491 8:17221514-17221536 TTAAATACCAATTACTTAGTTGG - Exonic
1038722477 8:30049370-30049392 TTAATTACTTATTAATTAGGAGG + Intergenic
1038903774 8:31874263-31874285 TAAGAGACTTAATAGTCAGTTGG + Intronic
1038914523 8:32005742-32005764 TTAAATTATTATTATTTAGTGGG + Intronic
1039700313 8:39955221-39955243 TTAAAGAAATATTTGTTAATTGG - Intronic
1039920290 8:41888959-41888981 TGAAGGACTTATAAATTAGTGGG - Intronic
1041567467 8:59296029-59296051 TTAATGACTTACTAGTTTATGGG - Intergenic
1042292101 8:67179488-67179510 TTAAAGACTTAATGTTTAATTGG + Intronic
1043469756 8:80550561-80550583 ATTAAGACTAATTAGTAAGTGGG - Intergenic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1045396041 8:101761616-101761638 TTAAGACCTTATTATTTAGTTGG + Intronic
1046015736 8:108603077-108603099 TTTAAGACATATTAGTTCTTGGG - Intergenic
1046236479 8:111429776-111429798 TGACAGAATTATTAGTTACTGGG + Intergenic
1051586824 9:18735446-18735468 TTGAAGACTGATCAGATAGTGGG - Intronic
1052458288 9:28729253-28729275 TGAATGAATTATTTGTTAGTTGG - Intergenic
1052559955 9:30072322-30072344 ATAGAGAATTATTAATTAGTGGG + Intergenic
1052966437 9:34343999-34344021 TGAAAGATATATTAGTGAGTAGG - Intergenic
1053782112 9:41620866-41620888 GAAAAGTCTTATTAGTTAGATGG + Intergenic
1054170062 9:61831021-61831043 GAAAAGTCTTATTAGTTAGATGG + Intergenic
1054667476 9:67749794-67749816 GAAAAGTCTTATTAGTTAGATGG - Intergenic
1054838978 9:69714718-69714740 TTAAAGGCTTAATTATTAGTAGG - Intronic
1055218137 9:73892601-73892623 TTAAACACCTATTAGGTATTAGG - Intergenic
1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG + Intronic
1055653972 9:78435549-78435571 ATAAAGAGTTATTGGTCAGTGGG + Intergenic
1056911175 9:90702256-90702278 TTAAAGAATTATTTGTTACCTGG + Intergenic
1058021315 9:100092340-100092362 TTATAGACTTATTATTTGATTGG - Intronic
1058461583 9:105188921-105188943 CTTAAGACTTATTGGTCAGTTGG + Intergenic
1058761077 9:108132973-108132995 TTAAACACTTATTAGGTAAAAGG - Intergenic
1058885238 9:109318018-109318040 TTAAAGATTTATTAGATATTAGG - Intronic
1186413191 X:9361552-9361574 TCAAACACTTATTGGTTACTGGG - Intergenic
1187033312 X:15510753-15510775 TTAAACACTTACTAGTTGCTGGG - Intronic
1188783459 X:34313777-34313799 TTGAAAACTTATTTATTAGTTGG - Intergenic
1191197690 X:57742144-57742166 TTAAACCCTTATTAGATAGATGG + Intergenic
1195076821 X:101335236-101335258 TTAAAGAATTTTTATTTAGAAGG + Intergenic
1195491233 X:105472204-105472226 TCAAAGACGTATTATTTAGAGGG + Intronic
1195720054 X:107858508-107858530 TTAAATACTTAGTAATCAGTTGG + Intronic
1197329589 X:125137381-125137403 GTAAAGAGTTATTATTTACTGGG - Intergenic
1199537400 X:148918243-148918265 TTCAAGACTTATTGGCTAGCAGG + Intronic
1199840357 X:151640546-151640568 TTAAGGGCTTATTAGTTAGTGGG + Intronic
1201370712 Y:13260648-13260670 TTAAAGATATATTATTTATTTGG + Intronic
1202375614 Y:24233513-24233535 TAAAAGACTTAATATTTAGTAGG + Intergenic
1202495166 Y:25436605-25436627 TAAAAGACTTAATATTTAGTAGG - Intergenic