ID: 1094463582

View in Genome Browser
Species Human (GRCh38)
Location 12:30725928-30725950
Sequence AAAATCTTAAATGATATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 650}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094463582 Original CRISPR AAAATCTTAAATGATATTCA TGG (reversed) Intronic
901619778 1:10574490-10574512 AAAAGCTGAGATGATATACATGG - Intronic
901827337 1:11870762-11870784 AAAGACTTAAAAGATATTTAAGG + Intergenic
903123897 1:21234909-21234931 AGCATCTTAAATGATTCTCAAGG + Intronic
903377021 1:22873021-22873043 CCAATCTTAAATGATACTCTAGG - Intronic
906169446 1:43711819-43711841 TAAAAGTTAAATTATATTCAGGG + Intronic
906987476 1:50700095-50700117 AAAAACTCAAATGATATGAAAGG + Intronic
908472203 1:64455393-64455415 AAAGTCTTAATTATTATTCAAGG - Intergenic
908644241 1:66260139-66260161 ATCACCATAAATGATATTCATGG + Intronic
909906580 1:81203134-81203156 AAGATATAAAATGATTTTCAGGG + Intergenic
910171314 1:84380311-84380333 AAAATTTTAAATTATATATATGG + Intronic
910196598 1:84647724-84647746 AAAATTTTAAATTATATTTTTGG - Intronic
910406079 1:86891647-86891669 AAAATTTTAAATAATATTTTGGG + Intronic
910511435 1:88010749-88010771 AAAATATAAAAGGATTTTCATGG - Intergenic
910555012 1:88521983-88522005 AAAATCCTAACTGATATTTTTGG + Intergenic
910781801 1:90945201-90945223 AAAATCTTAATTGATATATAAGG - Intronic
911240100 1:95455746-95455768 AAAAAAGTAAATGATTTTCAAGG + Intergenic
911399329 1:97355057-97355079 AAATTCATAAATGATTTTTATGG - Intronic
911411533 1:97515238-97515260 ATAATGTTAAATGAAACTCAGGG + Intronic
911477794 1:98395188-98395210 CAAATCATATCTGATATTCAGGG - Intergenic
911653151 1:100412328-100412350 TAGATCTGAAATGATATACAAGG + Intronic
911938319 1:104009727-104009749 AAAATTAAAAAGGATATTCAGGG - Intergenic
912375577 1:109207202-109207224 AAAATCCTAGATGATATCAAGGG + Intergenic
912937528 1:114016697-114016719 AAAATTCAAAATGATATTCAGGG + Intergenic
915045606 1:153012061-153012083 AAAATCTTTCATGATTTTCCAGG + Intergenic
915059372 1:153167748-153167770 ATAATTTTAAATGATAATAAAGG + Intergenic
916575238 1:166060881-166060903 AAAAACTAAAATAATATTAAAGG + Intronic
916959160 1:169872004-169872026 AAAATCTCAGGTGACATTCAAGG + Intronic
917029022 1:170669341-170669363 AAAATCTAAAATGACACTCCTGG - Intronic
917233625 1:172865453-172865475 AAAATCTTAATTTCTTTTCATGG + Intergenic
917608257 1:176658601-176658623 AAAATTCTAACTGACATTCAAGG - Intronic
917667527 1:177239772-177239794 GAAATCTTAAAATATACTCAGGG - Intronic
918055733 1:181020453-181020475 AAAATGTAAAATGACATACATGG + Intronic
918227172 1:182494515-182494537 AAAATTTTAAATTATATACGTGG + Intronic
918269252 1:182880706-182880728 AAAATCCTAAATGTTCTTCAGGG + Intronic
918559711 1:185849984-185850006 AGAAACTTATATTATATTCATGG + Intronic
918641623 1:186848011-186848033 AGAATCTTAAATCCTATACAAGG + Intronic
918698425 1:187575873-187575895 AAAATCTTAAATGCCAGTAAGGG + Intergenic
918870318 1:189964106-189964128 AAAATCTTTAAACATATCCATGG - Intergenic
919016209 1:192040418-192040440 AAAATCATAAATGATTTACATGG + Intergenic
919139622 1:193554593-193554615 AAAATCTTAATTCATACTCAGGG - Intergenic
919299919 1:195747856-195747878 ATAATCTCTAATGATATTGAAGG + Intergenic
920892891 1:210010192-210010214 AAATTTTTGGATGATATTCAAGG + Intronic
921041496 1:211437215-211437237 AAGAGGTTAAATTATATTCAGGG + Intergenic
921508025 1:215997505-215997527 AAAATCTGAATTAATACTCAGGG + Intronic
921559717 1:216642674-216642696 GAAAGCTTTAATGGTATTCAAGG - Intronic
921575949 1:216834981-216835003 AAAATGTTCTATGATAATCAGGG + Intronic
922346982 1:224704443-224704465 AAAATGTTAAATGAGACTCAGGG - Intronic
922853000 1:228750085-228750107 ACAACCTTAAATGATTTTTATGG + Intergenic
923694111 1:236229690-236229712 AAAATATCAAATGCTATTAATGG - Intronic
923967438 1:239157149-239157171 AAAACCTCAAATAATATGCACGG - Intergenic
924130982 1:240908075-240908097 AAAATGTTCAGTGATATCCAAGG + Intronic
924211635 1:241773868-241773890 ATAATATTAAAGGATATTAATGG + Intronic
924446182 1:244133940-244133962 AATATCTTTAATGTTATTCAAGG + Intergenic
1063135342 10:3211732-3211754 AAAATCTAAAATGATAATAATGG - Intergenic
1063477968 10:6345248-6345270 AACAAATTAAATGATATTTAAGG - Intergenic
1063701847 10:8392694-8392716 AACATTTTAAATGAAATTCCTGG + Intergenic
1063737943 10:8782521-8782543 AAAACCTTAAATGAAAATGAAGG - Intergenic
1063785138 10:9374065-9374087 AAAATATTAAATGATATCAGAGG + Intergenic
1063843373 10:10097501-10097523 AAAATATTAAATAATATAAAGGG - Intergenic
1065413975 10:25464278-25464300 AAAATCTTAGAAGATATTGCAGG + Intronic
1066486867 10:35854223-35854245 AAAATTTTAAATAATGTTCATGG + Intergenic
1066662516 10:37750723-37750745 AAAATCTCAAATGATAATAATGG - Intergenic
1067307809 10:45081489-45081511 AAATTTTTAAATAATTTTCATGG + Intergenic
1067774766 10:49155171-49155193 AAAATAATAACTGACATTCATGG + Intronic
1068489187 10:57700489-57700511 GAAATCCTAAATAATAATCATGG - Intergenic
1068664308 10:59656914-59656936 AAAATATTAAATGGCGTTCAGGG + Intronic
1069401001 10:68046669-68046691 TAAATCTTAAAAGATAGTCCAGG + Intronic
1070087891 10:73254529-73254551 AAAATCTTAATTTCTTTTCAAGG + Intronic
1070190521 10:74107820-74107842 AAGATCTTAAATTATAGTTAGGG - Intronic
1070302489 10:75214226-75214248 AAAATCAGAAATCACATTCAAGG - Intronic
1071125948 10:82334984-82335006 AAAATCTTAGCTGATATTGTTGG + Intronic
1071440604 10:85689027-85689049 AAAATTCTAAATGATATCAACGG - Intronic
1071452803 10:85814617-85814639 ATACTTTTAAATGATATTAACGG + Intronic
1072005114 10:91237964-91237986 AAAATTTTAAATTATACACATGG - Intronic
1072457158 10:95586754-95586776 TTAATATTAAATGATATTTAAGG - Intergenic
1073526345 10:104185852-104185874 AAACTCTGAAAAGATATTGAAGG - Intronic
1073852404 10:107636091-107636113 AAATTCTTCTATGATATTTAAGG - Intergenic
1074919721 10:117994845-117994867 AAAATCTAAAAAGAAATTCCTGG + Intergenic
1075119508 10:119654180-119654202 CAAATACAAAATGATATTCAAGG - Intronic
1075907543 10:126094716-126094738 ATAATCTTAAATGAAATGAATGG - Intronic
1076644108 10:131939885-131939907 AAAATCTCAGATGAAACTCAGGG - Intronic
1077148807 11:1059007-1059029 AAAATTTTAAATTATTTTAATGG - Intergenic
1077734816 11:4779267-4779289 TGAATCTAAATTGATATTCATGG - Intronic
1077780432 11:5322794-5322816 AAAATATTAAATGCAAATCATGG + Intronic
1077941147 11:6844913-6844935 AGAATCTTAAATGATATAAAAGG - Intergenic
1078324194 11:10366252-10366274 AAAATCATCCATGATAGTCAAGG - Intronic
1078324410 11:10368057-10368079 AACCTCTTCACTGATATTCAAGG + Intronic
1078460133 11:11508845-11508867 ATACTCTTAAATGCTATGCAAGG + Intronic
1078945300 11:16060028-16060050 AAAAGCATAAATGATAACCAAGG - Intronic
1078953781 11:16166456-16166478 GAAATCTTAAATCATTTTAATGG - Intronic
1079491457 11:20993118-20993140 AAACTCTTACATGATATTCATGG + Intronic
1079694387 11:23460951-23460973 TATATTTTAAATGATAATCAGGG - Intergenic
1079899637 11:26166190-26166212 AAAATCACAATAGATATTCATGG + Intergenic
1080215651 11:29836994-29837016 AAAATCTTAGATGATGGTGATGG - Intergenic
1081075190 11:38664126-38664148 GATATTTTAAATGGTATTCAAGG - Intergenic
1081392832 11:42549504-42549526 ATAATGCTTAATGATATTCAAGG - Intergenic
1082050204 11:47765132-47765154 ATAATCTTAAATCATATTTTTGG + Intronic
1082942662 11:58724729-58724751 TAAATCTAAAATGAAATTAATGG - Intronic
1083038446 11:59662975-59662997 AAAATCTAAAATGATGATGATGG - Intronic
1084292768 11:68185677-68185699 AAAATTTAAAATGACATTAAAGG - Intronic
1084711112 11:70844284-70844306 AACAGCTTGAATGCTATTCAAGG - Intronic
1084869457 11:72087861-72087883 AAAATTTTAAATTATATATATGG + Intronic
1084991369 11:72928504-72928526 AAATACTTAAATGATAATGATGG + Intronic
1085005847 11:73089238-73089260 AAACTTTTAAATGATATTAATGG + Intronic
1085571362 11:77560691-77560713 AAAATCTGAAATGATAGGCTGGG - Intronic
1086756217 11:90566064-90566086 GAAATCATAAAAGATATTCCAGG - Intergenic
1086835121 11:91611333-91611355 AAAATCTTAAGCTATATTCTTGG - Intergenic
1086908461 11:92444629-92444651 AAATACTTTAATGATATTAATGG + Intronic
1086931530 11:92698779-92698801 AAGACCTTATATTATATTCATGG + Intronic
1087385834 11:97467511-97467533 CTAATCTGAAATGTTATTCATGG - Intergenic
1087436922 11:98131875-98131897 AATATCTTATATGTTCTTCAAGG + Intergenic
1087468013 11:98534802-98534824 GAAATCTTAAATGAAATCCATGG + Intergenic
1087725419 11:101710234-101710256 AAAATCTGAAATGAAAATAAGGG + Intronic
1088145657 11:106673244-106673266 TAGTTCTTAAATGATAATCACGG - Intergenic
1088723575 11:112615307-112615329 AAAATCTAAAAGAATGTTCAAGG - Intergenic
1088843678 11:113647423-113647445 AAAATCTCAAGTGATAATGAAGG + Intergenic
1089228093 11:116943869-116943891 AAAATCTGAAATTATATAAATGG - Intronic
1090595172 11:128313366-128313388 AAAATTTAAAATTATATACATGG + Intergenic
1090687953 11:129145526-129145548 TAAAACTTACAAGATATTCAAGG - Intronic
1090859929 11:130643973-130643995 AAAATCTGAAAACATATTAAGGG - Intergenic
1092897313 12:13025065-13025087 GAAATCTTAAATTGTATTCAGGG - Intergenic
1093330945 12:17838037-17838059 ACAATCTTAAATGTAAATCAAGG - Intergenic
1093418691 12:18949929-18949951 AAAATTTTAAATAATACTTATGG + Intergenic
1094084168 12:26571201-26571223 AAAATCTAACATGATATACATGG + Intronic
1094253377 12:28393070-28393092 AAACTCTGAAAAGATAATCATGG - Intronic
1094320523 12:29178021-29178043 AAAATTTCAAATGCAATTCATGG + Intronic
1094399474 12:30045916-30045938 AAAATCATCAATGATTATCAGGG + Intergenic
1094463582 12:30725928-30725950 AAAATCTTAAATGATATTCATGG - Intronic
1094464365 12:30736235-30736257 AAAGTCTGACATAATATTCATGG + Intronic
1095469821 12:42524745-42524767 ACAATCATAACTGATATACAGGG - Intronic
1095492254 12:42746901-42746923 ACAATTTTAAATGATATCAATGG + Intergenic
1096269039 12:50149091-50149113 ACAATCTTAAAAAATTTTCAAGG - Intronic
1096735869 12:53653880-53653902 AAAAACTTAAATGAGGTCCAAGG - Intronic
1097075654 12:56391547-56391569 AAAATAAAAAATGTTATTCAGGG + Intergenic
1097674632 12:62585866-62585888 AAAATCATAAATCATATTTTAGG + Intronic
1097674975 12:62590476-62590498 AAACTGTAAAATGATATACAGGG + Intronic
1098011609 12:66059149-66059171 AAAATTACAAATGATATGCATGG + Intergenic
1098637317 12:72800495-72800517 AAAATATTAAATAATTATCAAGG - Intergenic
1098724058 12:73939893-73939915 ATAATTTTAAAGGATATTAAAGG + Intergenic
1098861846 12:75719344-75719366 AAAAGCTTAAATGAAAGCCAAGG + Intergenic
1099131470 12:78838237-78838259 AAAAACTTTATTGATATTCAGGG + Intergenic
1099135243 12:78889799-78889821 AAAACCTTAAATATTCTTCAAGG + Intronic
1099642499 12:85310135-85310157 AAAGTCTTATGTGACATTCATGG + Intergenic
1099773360 12:87093212-87093234 AAAGACTTAAATAATATTGAAGG - Intergenic
1100038880 12:90287207-90287229 AAAATTTTAAAAGTTCTTCAGGG - Intergenic
1100860966 12:98806451-98806473 AAAAACTAAAATGATTTTAAAGG + Intronic
1101116344 12:101535482-101535504 AAAATTTGCAATGATATTCATGG - Intergenic
1101635792 12:106540525-106540547 AAAGTCTTATCTGAGATTCAAGG + Intronic
1101726153 12:107389995-107390017 GACTTCTTAAATGGTATTCAGGG + Intronic
1101974058 12:109339539-109339561 AAAATCCTAAATAATGTTGAAGG + Intergenic
1104623455 12:130335392-130335414 AAAATTTGAAAAGAAATTCAAGG - Intergenic
1105872882 13:24523610-24523632 AAAATATTACATGATATGCAGGG - Intergenic
1106040007 13:26081033-26081055 AAAAAGTTTTATGATATTCACGG - Intergenic
1106223900 13:27770752-27770774 AAAATAATAAGTGGTATTCATGG - Intergenic
1106781910 13:33067307-33067329 AAAATTTAAAATGAAATACATGG - Intergenic
1106892748 13:34263770-34263792 AAATTCTTAAATGATGTTAGAGG - Intergenic
1107222685 13:38004545-38004567 AAAATCATAAAGTTTATTCATGG + Intergenic
1107573492 13:41689623-41689645 AACATTTTAAATTACATTCATGG + Intronic
1107848248 13:44542017-44542039 GAAATCTTAGATAATTTTCATGG - Intronic
1108472526 13:50781941-50781963 TAAATGTTCAAAGATATTCATGG - Intronic
1108941124 13:55954058-55954080 AAACTCTTAAATGTTGTTAATGG + Intergenic
1109010735 13:56939281-56939303 ACAATCTTAAAAGTTATTGAAGG + Intergenic
1109492801 13:63126014-63126036 AAAATTTTACATGCCATTCAAGG - Intergenic
1109559890 13:64032958-64032980 AAAGCCTTAAAGGATAGTCAGGG + Intergenic
1109623534 13:64942311-64942333 AAGATTTTAAATAATATTGAGGG - Intergenic
1109808969 13:67483888-67483910 AATATCATAAAGGATAATCATGG - Intergenic
1109879164 13:68449498-68449520 ATAAACTTAAAGAATATTCAAGG - Intergenic
1109916783 13:68998950-68998972 AATATATTAAATTATTTTCAAGG + Intergenic
1110322659 13:74177527-74177549 AAAACCTTACATGAAATTTAAGG + Intergenic
1111035578 13:82667998-82668020 AAAAGCATAATTGATATTGAAGG + Intergenic
1111088141 13:83403608-83403630 AAAATTTTTATTGATATTCTTGG + Intergenic
1111908294 13:94281410-94281432 AAAAAATGATATGATATTCAGGG - Intronic
1112973948 13:105294089-105294111 AAAATCATTAATTATTTTCATGG + Intergenic
1113242742 13:108357275-108357297 TAAAACTTAAATAATATTTAAGG + Intergenic
1113261529 13:108570031-108570053 AAAATCTTCAATAAAATACAAGG - Intergenic
1113292900 13:108925617-108925639 AAAATCTGGAATGTTATTCTTGG + Intronic
1114034736 14:18612806-18612828 AAGTTCTTTAATCATATTCAAGG + Intergenic
1114123906 14:19702210-19702232 AAGTTCTTTAATCATATTCAAGG - Intergenic
1114856787 14:26456515-26456537 AAAATGGTGAAAGATATTCAAGG + Intronic
1115156631 14:30347651-30347673 AAAATAATCTATGATATTCATGG + Intergenic
1115378056 14:32700482-32700504 AAAATATTAGATTATAGTCATGG + Intronic
1115538430 14:34395505-34395527 AAAATATTAAGAGATATTTATGG + Intronic
1115567830 14:34639902-34639924 AAAATCCTAAAGGAGATTCATGG - Intergenic
1116070909 14:40044385-40044407 AAATTGTTAGATGATATTAAAGG + Intergenic
1116072734 14:40069793-40069815 AAAATGTGAAATTATGTTCATGG + Intergenic
1116122157 14:40734806-40734828 AAATACTTAAATGATAATTAAGG + Intergenic
1116392355 14:44408423-44408445 AAAATCTCAAATAATATTGGAGG - Intergenic
1117296470 14:54384442-54384464 AAAATCACAAATGATCTTTATGG - Intergenic
1117547113 14:56802577-56802599 ATTATCTTAAATGTTATTCTGGG - Intronic
1119277137 14:73368252-73368274 AAACTATGAAATGGTATTCAAGG + Intronic
1120272879 14:82336673-82336695 TAAAACTTCCATGATATTCATGG - Intergenic
1120297543 14:82663061-82663083 TAAATTTTAAATCATATTTATGG + Intergenic
1120477392 14:85005703-85005725 AAAATCTTGAATAATTTTTAGGG + Intergenic
1121579436 14:95016157-95016179 AAAAGCATTAATGGTATTCAGGG + Intergenic
1122273059 14:100577010-100577032 AAAATGTAAAAGGATAATCACGG + Intronic
1122531515 14:102430889-102430911 GTAATCTTAAAGTATATTCAAGG + Intronic
1124936482 15:34176990-34177012 AGAATCTGAAATGGTATTAAGGG + Intronic
1125103381 15:35941947-35941969 GGAATATTAAATGATTTTCAAGG - Intergenic
1125113309 15:36059355-36059377 AATATCCTAAAATATATTCAAGG + Intergenic
1125118499 15:36124065-36124087 AAAATCCAAAATAATATTAATGG + Intergenic
1125305916 15:38313446-38313468 AAGATGTTATATGATATTCTGGG - Intronic
1125593194 15:40868116-40868138 AAAATCTTAAAAAGTATTCTAGG - Intergenic
1127721155 15:61701236-61701258 AAAAACACAAATGGTATTCAGGG - Intergenic
1128027854 15:64453630-64453652 TTATTGTTAAATGATATTCAGGG + Intronic
1129024507 15:72557648-72557670 AAAATCTTAAAAGAAAATCCAGG - Intronic
1129509092 15:76107083-76107105 AAAATTTTAAATGGCATACATGG - Intronic
1129830647 15:78667718-78667740 CAAATCTTCCATGACATTCAAGG + Intronic
1129962055 15:79696271-79696293 AAAATCTTAAAAGATTTTCTCGG - Intergenic
1130091679 15:80826424-80826446 AAAGTGTTAAGTGATATTCTTGG - Intronic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1130380764 15:83370884-83370906 AAAATTTGAAAAGATGTTCAAGG + Intergenic
1130691901 15:86088741-86088763 AAAATCTTTAAAGACACTCATGG + Intergenic
1130852618 15:87810594-87810616 AAAATCCTAAAGGTTTTTCATGG - Intergenic
1131370504 15:91877266-91877288 AAAATTTTAAAATATATACAAGG - Intronic
1132361010 15:101215273-101215295 AAAATCTTAAAAGGTTTTCCAGG + Intronic
1134251264 16:12575693-12575715 AAAATTTTAAATGGCATACATGG - Intergenic
1134587646 16:15425896-15425918 AAAATCGTAAAAGATATAAATGG - Intronic
1135698101 16:24608015-24608037 AAAATCTTCACTGACATTCTGGG - Intergenic
1136464677 16:30434306-30434328 AAAATCTAAAATGAAACTCGTGG - Intergenic
1137011239 16:35322467-35322489 AAAATTTTAATTGATACACATGG - Intergenic
1137769120 16:51001840-51001862 AAAATTTTAAATTACATTTATGG - Intergenic
1137909038 16:52357110-52357132 AAAATTCTAATTGATATTCTTGG - Intergenic
1139086908 16:63598200-63598222 AAAATTTTAAAAGATATAGATGG - Intergenic
1139747546 16:69086924-69086946 AAAAACTTAAACGAAATACACGG + Intergenic
1140544861 16:75797570-75797592 AAAATCTGAAAAAAAATTCAAGG - Intergenic
1141332320 16:83122781-83122803 AGTATCTAAAAAGATATTCAAGG + Intronic
1142013365 16:87729119-87729141 AAATTCTTAAATACTTTTCAAGG - Intronic
1144216719 17:13062350-13062372 AAATTCATAAGTAATATTCAGGG - Intergenic
1145352851 17:22103019-22103041 TAAATCATGAATGATATTCTGGG - Intergenic
1145925883 17:28646258-28646280 AAAATCTTGAAGGATATATATGG - Intergenic
1147436042 17:40416421-40416443 AAAATCTTTGATGAGATTCTAGG - Exonic
1147471542 17:40666695-40666717 AAATTCCTAAATTAAATTCAGGG + Intergenic
1148201901 17:45754925-45754947 AAAATTTAAAATTATATACACGG + Intergenic
1149144827 17:53477941-53477963 AAAACCTTAAGTGAGATTCTGGG - Intergenic
1149224946 17:54458925-54458947 AAATTCTTACATGACCTTCAAGG - Intergenic
1149433286 17:56611865-56611887 AAGATCTAAATTGATATTGAAGG + Intergenic
1150375809 17:64680850-64680872 AACATCTTAAAAGACAGTCAGGG + Intergenic
1150718444 17:67593127-67593149 ATATTCTTAAATGATTTTAATGG - Intronic
1152183082 17:78837159-78837181 AAAATTTTAAATTATATTTGTGG + Intronic
1153343191 18:3997651-3997673 AAAATTTTAAATTATATTTGTGG - Intronic
1153578699 18:6549739-6549761 AAAATCTTACCTGAGACTCAAGG + Intronic
1153910573 18:9702995-9703017 ATAATCTTAAATAAAATTTATGG + Intergenic
1154487210 18:14881908-14881930 GAAATATTAAAGGTTATTCAAGG - Intergenic
1155465954 18:26135114-26135136 AAAAACTTAAAAAATACTCAGGG + Intronic
1155672974 18:28394693-28394715 AAAATCCAAAATTATAATCAGGG + Intergenic
1155844679 18:30690886-30690908 AAAATCTTATAAGAAATTTATGG - Intergenic
1155848046 18:30733527-30733549 AAAATTAACAATGATATTCAGGG + Intergenic
1156076098 18:33281363-33281385 TAAATCGTAAATTATATTGAAGG + Intronic
1156436537 18:37136321-37136343 AAAATTTTGTATTATATTCATGG + Intronic
1157165258 18:45352842-45352864 AAAATATTAAATAATATTCCAGG + Intronic
1157203663 18:45680508-45680530 AAAATGTTGAATGACATTTATGG + Intronic
1158021774 18:52850794-52850816 AAAATGTAAAATCATATTTAGGG + Intronic
1159303175 18:66604624-66604646 AAAATCTTTTATTTTATTCATGG + Intergenic
1159508428 18:69364681-69364703 AAAATCTGATGTGATATTGAAGG - Intergenic
1159624246 18:70673336-70673358 AAAATCTCCAATGCTGTTCACGG - Intergenic
1159738010 18:72127425-72127447 AAAATATAAAAGAATATTCATGG - Intergenic
1159865694 18:73702312-73702334 GAAATCTTAAATATTCTTCAGGG - Intergenic
1160260829 18:77292648-77292670 AAAATGCTAAAAGATTTTCATGG - Intergenic
1160366966 18:78334833-78334855 AAACTCTTATATGGTCTTCAAGG + Intergenic
1164114595 19:22206877-22206899 AAAATGTTAAATTTTATTGAAGG - Intergenic
1164403140 19:27916749-27916771 AAAACCCGAAATGATAATCAAGG - Intergenic
1164547271 19:29178512-29178534 AAAATGTTATTTCATATTCATGG + Intergenic
1164571075 19:29374793-29374815 CAAATCTTATTTGATCTTCAAGG - Intergenic
1164870254 19:31637467-31637489 AAAATCGCAACTGATATTTAGGG - Intergenic
1165550852 19:36584357-36584379 AAAATTTTAAATGATGAGCAAGG + Intronic
1166286019 19:41829067-41829089 AAAATTTCAAATCATATACAAGG - Intergenic
925567110 2:5268379-5268401 AAAAGCTTAAATGAAAACCAAGG + Intergenic
926430494 2:12780463-12780485 AAAAAGATAAATAATATTCAAGG - Intergenic
926449672 2:12987007-12987029 AAAATATGCAATGATTTTCAGGG - Intergenic
927180177 2:20440311-20440333 AAAATCCTACTTGTTATTCAAGG + Intergenic
927532815 2:23824502-23824524 ACAATTTTAAATGATAATTATGG - Intronic
927951644 2:27174019-27174041 AAAATCTTCAATGAAAGACAGGG - Intergenic
928012209 2:27620069-27620091 AAAATTTTAAATTATATACATGG - Intronic
928049174 2:27970692-27970714 AAAAGCTAAAAGGATATTAATGG - Intronic
928054228 2:28035203-28035225 ATAATCTTAAATTATATATATGG + Intronic
928543336 2:32304744-32304766 AAAAACTTCAAGGAAATTCAGGG - Intronic
928973332 2:37055494-37055516 TAAATGTTAAATGATGTTAAAGG - Intronic
929642091 2:43591928-43591950 TAAGTCTGAATTGATATTCATGG - Intronic
929691141 2:44074759-44074781 AAAATTTTAAATGATATATGTGG + Intergenic
930162876 2:48176246-48176268 AAAGTCTTATATGAGACTCAAGG + Intergenic
930237504 2:48902133-48902155 ATAATGTTAAATAATATTAAAGG + Intergenic
930278717 2:49343706-49343728 AATATCTTTAATGAAAATCATGG - Intergenic
930477289 2:51899010-51899032 AATATGTTAAATGATAAGCATGG - Intergenic
931034438 2:58222260-58222282 AAAATCTCAAGTTATTTTCATGG - Intronic
931145909 2:59518163-59518185 AAAATCTTAAAAGATATAGTAGG - Intergenic
931597450 2:63964951-63964973 TAAATATTAAATGACTTTCAAGG + Intronic
932146061 2:69318417-69318439 AAAATCCAAAATGATACACATGG - Intergenic
932851674 2:75193678-75193700 AAAATCTTATCTAATCTTCAAGG + Intronic
933442870 2:82335354-82335376 AAAATCTTACTTGTTATTCAAGG + Intergenic
933936679 2:87210195-87210217 AAAACATTAAATGATAATAAGGG - Intergenic
934648961 2:96077300-96077322 AAAAAATGAAATGATATTCCAGG - Intergenic
934731964 2:96664874-96664896 AAAAGCTCTAATTATATTCAGGG - Intergenic
935035495 2:99368366-99368388 AAAATATGAAAGGATATTCATGG - Intronic
935691186 2:105733868-105733890 AATGGGTTAAATGATATTCAAGG + Intergenic
935782823 2:106522984-106523006 AAAATTTTTAATGATTTTAAAGG + Intergenic
935857505 2:107291035-107291057 AAAATATTAAATGTTGTTTAAGG - Intergenic
936167824 2:110139285-110139307 AAAATCTGAAGTCAAATTCAGGG + Intronic
936356466 2:111755632-111755654 AAAACATTAAATGATAATAAGGG + Intergenic
936767235 2:115867017-115867039 AATATTTTAAATACTATTCATGG + Intergenic
936782094 2:116045854-116045876 GAAATGTAAAATGATACTCATGG - Intergenic
937196003 2:120156889-120156911 AAAATCAACAAAGATATTCAGGG + Intronic
937596304 2:123678582-123678604 AAAATTTTGATTGATATGCATGG + Intergenic
937710572 2:124976067-124976089 AAAATATAGGATGATATTCAGGG + Intergenic
937789162 2:125940092-125940114 AAAATTATAAATGATATTTTAGG - Intergenic
938276520 2:130030045-130030067 AAGTTCTTTAATCATATTCAAGG - Intergenic
938327479 2:130420805-130420827 AAGTTCTTTAATAATATTCAAGG - Intergenic
938362465 2:130700672-130700694 AAGTTCTTTAATAATATTCAAGG + Intergenic
938438853 2:131307314-131307336 AAGTTCTTTAATCATATTCAAGG + Intronic
939351476 2:141043614-141043636 AAAATATGAAATGATATGAAAGG + Intronic
939370469 2:141292573-141292595 AAAATCATAAATCATGTTGATGG + Intronic
939394869 2:141615719-141615741 AAACTTTTAAATGTTCTTCAGGG - Intronic
939690269 2:145251104-145251126 AATATATCAAAGGATATTCAAGG - Intergenic
939849334 2:147285466-147285488 AAAATCTAAAATCATTGTCATGG + Intergenic
939954183 2:148511801-148511823 AAAATTTTAAATAATGTTTATGG - Intronic
940068512 2:149656675-149656697 AAAATCATAAATGAAAATCTTGG - Intergenic
940433489 2:153622301-153622323 AAGATCTTAAGTGATATTGACGG + Intergenic
940668515 2:156638942-156638964 GAAAACTAAAATGAAATTCAGGG - Intergenic
941248871 2:163136243-163136265 AATATATTGAATTATATTCATGG - Intergenic
941288714 2:163648067-163648089 GAAACCTTAAATGATTTGCAAGG + Intronic
941409432 2:165135268-165135290 CAAAACTTAATTGAGATTCAAGG + Intronic
942001623 2:171653549-171653571 AGAATCCTAATTGATACTCAAGG + Intergenic
942205541 2:173616914-173616936 AAAATCTATAAGGATATTCATGG + Intergenic
942400310 2:175594611-175594633 AAAATCTGAAATTATATCAATGG + Intergenic
942845164 2:180415450-180415472 ATATTTTTAAATGATATTTATGG + Intergenic
942873373 2:180763112-180763134 AAAATCTTAAATGAAATTTGAGG - Intergenic
943312961 2:186350408-186350430 AAAATATCAAATCAAATTCAAGG + Intergenic
943381258 2:187151610-187151632 AAAATCTGAAATCATATTTATGG + Intergenic
943471182 2:188294715-188294737 AAAAACTGAAATCATAGTCAGGG - Intronic
944180586 2:196888160-196888182 AAAACCTTAGAAGTTATTCAAGG + Intronic
944596673 2:201267338-201267360 AAAATTTTCAATGAGATTTAAGG + Intronic
944676659 2:202038612-202038634 AAAAAATTAAATGACAGTCAAGG - Intergenic
944725544 2:202467750-202467772 AAAAACTTAAAAAACATTCAAGG + Intronic
945455088 2:210042848-210042870 AAAAACTAAATTGAGATTCAGGG + Intronic
945522146 2:210842091-210842113 AATATCATAAATGCTATTGAAGG - Intergenic
945759019 2:213888228-213888250 AAAATGTTAAATAATTTCCATGG - Intronic
945822580 2:214682946-214682968 AAAATGATAAATGATAGACATGG - Intergenic
945831240 2:214788942-214788964 AAAATCTCAAATGCCCTTCAAGG + Intronic
946141809 2:217697698-217697720 AAAATGTTAAGTGACATTTAAGG + Intronic
946628292 2:221638836-221638858 AAATTCTTAAAAAATATTCCTGG - Intergenic
946633864 2:221702592-221702614 AAGATCGTAAAGGATATTCTAGG + Intergenic
948241146 2:236436309-236436331 AAAATCACAAATGAAGTTCAAGG - Intronic
948400795 2:237683461-237683483 AAGATCTTAGATGAACTTCAGGG - Intronic
1169045620 20:2532572-2532594 AAAATTTTAAATTATTTGCATGG - Intergenic
1169331819 20:4722287-4722309 GAAATCTTAAATAAGATTAATGG - Intronic
1169803722 20:9537790-9537812 AAAATCATAGATCATATTTATGG + Exonic
1169813463 20:9632162-9632184 ATAATGTGAAATGATATTCTAGG - Intronic
1169885026 20:10389605-10389627 AAAATCTTAAAGGATTTTCATGG + Intergenic
1170435450 20:16322992-16323014 AAAATCATAAAAGATAGGCAAGG - Intronic
1171005581 20:21462473-21462495 AAAATATTTAATGAAATTTAAGG + Intergenic
1172492095 20:35347932-35347954 AAAATTTTAAATTACATACATGG + Intronic
1172542978 20:35736458-35736480 AAAATATATAATGTTATTCAGGG - Intronic
1172988056 20:39008998-39009020 AAAAGCTTCAGTGATATGCAGGG - Intronic
1173268696 20:41511603-41511625 AAAACCTTAGGTGATACTCAAGG + Intronic
1174631359 20:51960805-51960827 AAAATCTAAAATGTTCTTGAGGG - Intergenic
1174652678 20:52141411-52141433 AGAATCATGAATGATCTTCATGG - Intronic
1174658154 20:52189070-52189092 AAAATATTTTATAATATTCATGG - Intronic
1176642041 21:9314618-9314640 AAAATATTAAGTGCTATTTATGG + Intergenic
1176794074 21:13357405-13357427 GAAATATTAAAGGTTATTCAAGG + Intergenic
1176895576 21:14374665-14374687 AAAATTTTAAATTATATAAAAGG + Intronic
1177327051 21:19604386-19604408 AAAATGTAAAATGAAATTTATGG - Intergenic
1177880781 21:26691420-26691442 AAGAACTCAAATGATATCCAAGG - Intergenic
1177923218 21:27180847-27180869 AAAATGTTACATGATAATAATGG + Intergenic
1177934292 21:27323301-27323323 AAAAATCTAAATGAGATTCATGG - Intergenic
1178745520 21:35246346-35246368 AAAATCCTAAAGAATATTCTTGG + Intronic
1178995497 21:37395449-37395471 AAAATCTTAGATGTTAATCATGG + Intronic
1179220696 21:39404441-39404463 AAACTCAAAAATGATTTTCATGG + Intronic
1179319534 21:40276793-40276815 ATAACATTAAATGATATTAATGG - Intronic
1180153830 21:45967474-45967496 AAAATCTTTCCTCATATTCAGGG - Intergenic
1180387148 22:12188103-12188125 AAAATATTAAGTGCTATTTATGG - Intergenic
1180458857 22:15539854-15539876 AAGTTCTTTAATCATATTCAAGG + Intergenic
1181319367 22:21992636-21992658 AAAAAATTAAATGAAATTCATGG + Intergenic
1182660490 22:31921445-31921467 AAAATTTTAGATGATGTTAAGGG - Intergenic
1182907453 22:33950369-33950391 AAAACCTTTAATGATCTGCATGG - Intergenic
1183131604 22:35842539-35842561 AAAATCTTGAATCATACTAATGG + Intronic
949657494 3:6237852-6237874 AAACATTTAAATGATCTTCAAGG + Intergenic
950299167 3:11860321-11860343 AAAATCTCAAAAGTCATTCAAGG + Intergenic
950369683 3:12518569-12518591 AAAATCTGAAATTATACACATGG - Intronic
950815940 3:15702479-15702501 AAAATCTGAAAAAATATTTAAGG + Intronic
951347600 3:21564966-21564988 TAAATCTTTAATTATATTTAAGG - Intronic
951512556 3:23519940-23519962 GAAATGTTTAATGATATTCATGG - Intronic
951717027 3:25660500-25660522 TAAATCTTAACTGTTCTTCAGGG - Intronic
951811097 3:26701175-26701197 TAAATATTAAATGAAATTCAGGG - Intronic
951907486 3:27719703-27719725 AAATTCTGAAATGCCATTCAGGG - Intronic
952445234 3:33375033-33375055 AAAATTTTAAATAATATAAATGG - Intronic
952806325 3:37356769-37356791 ATAATTTTAAATGATATAAAAGG + Intronic
953196848 3:40742410-40742432 AAAATCTCTAATAAAATTCATGG + Intergenic
953598781 3:44343398-44343420 AAAATTTTAAATTATATCCAAGG - Intronic
955031659 3:55227683-55227705 AAAATGTTAAATTTTATTCTAGG + Intergenic
955433726 3:58877130-58877152 AAACTGTTAAATACTATTCACGG - Intronic
955693545 3:61613562-61613584 ACAATCTTTGATGAGATTCAGGG + Intronic
956831411 3:73052513-73052535 CAATTCCTAAATTATATTCATGG - Intronic
957158646 3:76579606-76579628 AAAATCTTAACTGAAAGTCTTGG + Intronic
957612675 3:82488828-82488850 AAATGTTTAAATGCTATTCAAGG + Intergenic
957832249 3:85537435-85537457 AAAATCTTATATGGTTATCAAGG + Intronic
957918616 3:86718775-86718797 AAAATTTTAAATTATACTAAAGG - Intergenic
957984409 3:87554609-87554631 AAAATATTAAATAATATTGGTGG - Intergenic
958179668 3:90043768-90043790 AAAATCTTAAAATATATATAAGG + Intergenic
958475312 3:94573339-94573361 AAAATCTTAGGAGATATTGATGG + Intergenic
958476581 3:94591784-94591806 AGAATCATAAATGAAATTGAAGG - Intergenic
958559274 3:95722870-95722892 GAATTCTTAATTGAGATTCACGG - Intergenic
958752086 3:98203591-98203613 AAAATCCTAAATGATGTACTTGG - Intergenic
959791260 3:110364874-110364896 AAAACCATAAATTATATTGAAGG - Intergenic
959923288 3:111893719-111893741 AAAATTTAAAATGACATTCATGG - Intronic
960575130 3:119221638-119221660 AAAATCATAAATGATAAACCAGG + Intronic
962085421 3:132186280-132186302 AAAATGTTAAATTATATACATGG - Intronic
962575998 3:136755604-136755626 AAAATAGTTAATGACATTCAAGG + Intergenic
963174452 3:142283241-142283263 AAAATCTTAATTGTTTTGCATGG + Intergenic
963809483 3:149761071-149761093 AAATTTTTAAATTATATTTAAGG - Intergenic
964027911 3:152100350-152100372 GAAATTTTAAATGATTTTCCGGG - Intergenic
964193560 3:154034463-154034485 AAAATCTCAAAACATATTTAGGG + Intergenic
964562604 3:158014208-158014230 CAAATCTTAAATAATCCTCAAGG + Intergenic
964785700 3:160393742-160393764 AAAATTTTAGATGATAAACAGGG + Intronic
964902761 3:161679679-161679701 CAAATCTGAAATGAAATGCAAGG - Intergenic
965134610 3:164746120-164746142 AAATTCTTACATAATGTTCATGG - Intergenic
965353817 3:167649008-167649030 AAAATTTTAAATGAACTTTATGG + Intronic
965366241 3:167803454-167803476 AATATAATAAATGATATTAATGG + Intronic
965462065 3:168978183-168978205 AAAATCTTAAATGTTTTTCTTGG + Intergenic
965893525 3:173544940-173544962 AAAATTTGAAATGATACTGATGG + Intronic
967296295 3:187968371-187968393 AAACACTTAAATGATATCTAGGG - Intergenic
967519259 3:190409740-190409762 AAAATCTTAAATTGTCTTCTAGG + Intronic
967610342 3:191498661-191498683 AAAATTTTAAAAGATATGAATGG + Intergenic
967662312 3:192127932-192127954 AAAAGTTTAAATCATATACATGG + Intergenic
1202744851 3_GL000221v1_random:90400-90422 AAAATATTAAGTGCTATTTATGG - Intergenic
968778709 4:2562445-2562467 GAAATTTTAAATGATCTTAAAGG - Intronic
969433153 4:7167763-7167785 AAAATCTTGAATTTGATTCAGGG - Intergenic
969911536 4:10451649-10451671 AAAATATAAAGTGAGATTCAGGG - Intronic
970481081 4:16475852-16475874 AAAATCTTCAACTATATTTATGG - Intergenic
970680540 4:18502374-18502396 AAAATCTTCAAAGTCATTCATGG + Intergenic
970786235 4:19799898-19799920 AAAATCAGAAATGAAATTCATGG - Intergenic
970817187 4:20170683-20170705 AAAACCTCAAATTATTTTCAAGG - Intergenic
970957223 4:21827827-21827849 AAAATGTTAAATGAAATTCTTGG - Intronic
971269195 4:25123098-25123120 AGAATCTTAAGTGATAACCAGGG - Exonic
971406465 4:26324974-26324996 CAAATCTGAAATTATAGTCATGG - Intronic
971822415 4:31575445-31575467 AAAATTTTAAATAAGCTTCATGG + Intergenic
971910984 4:32797783-32797805 TTAATCTTATATAATATTCAGGG + Intergenic
972026547 4:34385756-34385778 AAGACCTCAAATAATATTCATGG - Intergenic
972052354 4:34754061-34754083 AAAATATTAATTTATATGCAAGG - Intergenic
972849355 4:43029980-43030002 AAACTGTTAAATGATACTAATGG + Intronic
974060426 4:57028837-57028859 AAAAACTTATGTGATAATCAGGG - Intronic
974376091 4:61078005-61078027 AAAATCTTCAATAAAATGCAGGG + Intergenic
975201564 4:71596480-71596502 AAAATATTAAATAAAATTCATGG - Intergenic
975216201 4:71758693-71758715 AAAATATTTAATGTTATTCCTGG - Intronic
975409654 4:74035506-74035528 AAAATCTGAACTGATTTTTATGG - Intergenic
975599026 4:76080126-76080148 AAACTCATAAATGGTATTCCTGG + Intronic
975894122 4:79066138-79066160 AAAATCTAAATAGATTTTCAAGG - Intergenic
976036584 4:80830339-80830361 AAAATATTTAAGGCTATTCAAGG + Intronic
976044951 4:80934948-80934970 ATAATCTAAATTTATATTCAAGG - Intronic
976554148 4:86431464-86431486 AATATTTTATATTATATTCATGG + Intronic
976838374 4:89402127-89402149 AAAATTTTAAATGACATACATGG + Intergenic
976857911 4:89626981-89627003 TAGATCTTAAATGATACACAAGG + Intergenic
977546881 4:98393907-98393929 AAAATCTAAAATTATATATATGG + Intronic
977715634 4:100180314-100180336 AAAAACTTAAATAAAATTCTAGG - Intergenic
977787312 4:101052268-101052290 AAAAGCTTATTTGATAGTCAAGG + Intronic
978204171 4:106059844-106059866 AAATTCTTAAACGAAATTAAAGG + Intronic
978351908 4:107828169-107828191 GAAATGTTAAATGATTTTCTGGG - Intronic
978354210 4:107853533-107853555 ATAATATTAAATGATATTAGTGG + Intronic
978634949 4:110793654-110793676 ATAATCCTAAATGATACACATGG + Intergenic
978655260 4:111058612-111058634 AAAATATTTGATGATATTAAAGG + Intergenic
978705699 4:111707815-111707837 ATAAACTTAAATGATGTTAAGGG + Intergenic
979474717 4:121141558-121141580 AAAATGTTATATGTTGTTCAAGG + Intronic
979648718 4:123105574-123105596 TAAATCATGAATGATCTTCATGG - Intronic
979733084 4:124048503-124048525 GAATTCTTAAATAAAATTCAAGG + Intergenic
979884730 4:126012695-126012717 AAAATTTTATATGATATACTAGG + Intergenic
979921815 4:126505758-126505780 AAAATCTTGAGTTATATTAAGGG + Intergenic
980301608 4:131002583-131002605 AAAATCTGCAATAATATTCCTGG + Intergenic
980341394 4:131552333-131552355 TAACTTTTAAATGACATTCATGG - Intergenic
980666432 4:135943077-135943099 CATATCATAACTGATATTCATGG + Intergenic
980679904 4:136146830-136146852 AAACTCTTACATACTATTCATGG - Intergenic
981252523 4:142620995-142621017 AAAACCTTAAATGCTATTGAAGG + Intronic
981389105 4:144167215-144167237 AAAATCTTAAAAGCAATTAAAGG - Intergenic
981425604 4:144599400-144599422 AAAATATTAAACAATATTAAAGG + Intergenic
981534485 4:145785025-145785047 AAAAGCCCAAATGACATTCAAGG - Intronic
981943040 4:150306507-150306529 AAAATCTCAAACGATAGTCCTGG - Intronic
982619413 4:157684959-157684981 AAAATCATAATTTTTATTCATGG - Intergenic
983116494 4:163823975-163823997 AAAAACTTGAATGATATATAGGG - Intronic
983534060 4:168838786-168838808 AAAAGCTTAAATGAAATTTCTGG - Intronic
983690855 4:170467029-170467051 AAAATCTCAAATAATATTTGTGG - Intergenic
983849780 4:172566808-172566830 AAAATCGTAAATGACATTGGAGG + Intronic
984243366 4:177244916-177244938 AAAATGTTACATTATATTTATGG + Intronic
984960816 4:185095823-185095845 AAAATGGAAAATGAGATTCAAGG + Intergenic
987629725 5:20453409-20453431 AAGATCTTGAATGACTTTCATGG - Intronic
987749802 5:22024867-22024889 AAAATCTAAATTGATATATATGG - Intronic
987998721 5:25320327-25320349 AAAATCTGAGAAGACATTCAGGG + Intergenic
988177791 5:27749339-27749361 AAAATCCTAAAAGATATTTTAGG + Intergenic
988653465 5:33180245-33180267 AAAATATTAAATGATTTACAAGG - Intergenic
989011026 5:36873369-36873391 AAAATTTTAAATGGATTTCAGGG - Intergenic
989369697 5:40693387-40693409 TAAATTTTAAAGGATATTCTTGG - Exonic
989722604 5:44547591-44547613 AATATCTAAAATTATAATCAAGG + Intergenic
989752528 5:44912970-44912992 AAATACTTAAATTATATTTATGG + Intergenic
990830427 5:59950624-59950646 AATATCTTAAGTGATATCCTGGG - Intronic
990927337 5:61042206-61042228 AAAAATTTAAATTATAATCATGG - Intronic
991538500 5:67700235-67700257 AAAATCTTTAATCATATTGATGG + Intergenic
992607820 5:78478766-78478788 AATATCTAAAATAATGTTCATGG + Exonic
993321208 5:86469689-86469711 AGAATCATAAGTGATATTTATGG - Intergenic
993432846 5:87853136-87853158 AAAATCTTTATTAATATTCTTGG + Intergenic
993486918 5:88498118-88498140 AAAATCATAACTAATATTTATGG - Intergenic
993523838 5:88939945-88939967 CAAAACTTAAATGCTTTTCAAGG + Intergenic
993524833 5:88952282-88952304 TAAATGTCAACTGATATTCATGG - Intergenic
993813055 5:92507153-92507175 AAAATCTGAAACTATATTAATGG + Intergenic
994157135 5:96516068-96516090 AAAATCATTATTGATATTCTTGG - Intergenic
994337504 5:98585317-98585339 AAAATCTAAAATGTTTTCCATGG - Intergenic
994833497 5:104817203-104817225 AAAACTTTAAATAATATTTAGGG + Intergenic
995979189 5:118080664-118080686 AAAATCTTCAAATATCTTCAAGG - Intergenic
996443415 5:123516318-123516340 ATAATGTGAAATGATTTTCAAGG + Intronic
996476538 5:123929030-123929052 AAAATCTTAACTGCTTGTCATGG - Intergenic
997775233 5:136598200-136598222 ACAGTCTTGAATGATGTTCAAGG - Intergenic
997895744 5:137715339-137715361 GAAATGTTACATGATATTCCAGG - Intronic
999431145 5:151526453-151526475 AAAGGCTAAAATGATACTCAGGG - Intronic
999716449 5:154364699-154364721 AACACCTTAAACGATAGTCATGG + Intronic
1000845056 5:166269390-166269412 AAAATCTAAAAAGATATTAATGG - Intergenic
1001464371 5:171950224-171950246 ACATTTTTAAATGATATTCAGGG + Intronic
1003841186 6:10121548-10121570 AAACTTTTAAATGCTATTGAGGG + Intronic
1004453204 6:15766756-15766778 AAAATATAAAGTGATATTCCTGG + Intergenic
1004493718 6:16143373-16143395 ACCATTTTAAATGTTATTCAAGG + Intronic
1005605236 6:27470426-27470448 AAATTCTTAATTTATATTAATGG + Intronic
1006615884 6:35326587-35326609 ACTATCTTAAAAAATATTCAAGG + Intergenic
1006976746 6:38109484-38109506 ACAATCTTAAATGAAAGTCATGG - Intronic
1007018640 6:38496259-38496281 AATATTTTAAATAATATTAAAGG + Intronic
1007921484 6:45614099-45614121 AAAATTTTAAATTATATATATGG - Intronic
1007949172 6:45854904-45854926 AAAATATTAAATGATTGACAGGG - Intergenic
1008164409 6:48118469-48118491 AGAATATTTAATCATATTCATGG + Intergenic
1008186862 6:48403878-48403900 ATTATCTCAAATGATATTCATGG + Intergenic
1008238775 6:49083549-49083571 AAAGTTTTAAATGATATTAAGGG + Intergenic
1009606580 6:65877423-65877445 AAAATCTAAAGTTTTATTCATGG - Intergenic
1009802737 6:68562169-68562191 AAAATATGGAATAATATTCATGG - Intergenic
1009976806 6:70679888-70679910 AAAATTTTTAATGAAATGCAAGG + Intronic
1010096254 6:72049731-72049753 AAAATATTAAAGGATAATTAAGG + Intronic
1010114238 6:72282704-72282726 ACATTCTTAAAGGATTTTCATGG + Intronic
1010293989 6:74174461-74174483 AAAACATTAAAAGATAATCATGG + Intergenic
1010639044 6:78299687-78299709 TAAATCTTTATTGATATTCTAGG - Intergenic
1011015272 6:82747360-82747382 AAAATCTGCAGTGAGATTCAGGG + Intergenic
1011690819 6:89866440-89866462 AAAAAATTATATGAAATTCAAGG + Exonic
1012011056 6:93785958-93785980 AAAATCTTAAATGATTTAATAGG - Intergenic
1012394027 6:98775066-98775088 AAAATCTTAGCTGATTGTCATGG - Intergenic
1012723283 6:102776712-102776734 TAAATCATAAAAGAGATTCATGG - Intergenic
1012882594 6:104808597-104808619 AATATATTATATCATATTCAAGG - Intronic
1013218643 6:108055733-108055755 AAATTCTAAAATGATAATGAAGG + Intronic
1013705524 6:112829461-112829483 AAAATCTGAATTTATATTCAGGG + Intergenic
1013708446 6:112868512-112868534 AAAATCTTCAATGTTATTGCAGG - Intergenic
1013961798 6:115909938-115909960 AAAATTTTAAATTATATTCTTGG + Intergenic
1014208260 6:118680435-118680457 ATAAACTAAAATGATAGTCAAGG - Intronic
1014432193 6:121384211-121384233 AAAAACTTACATGAAATTTAGGG + Intergenic
1014636676 6:123855978-123856000 AAAATCTTAAAAGATATTGTGGG - Intronic
1014979039 6:127924575-127924597 AAAATCTTAATTCTTTTTCATGG + Intergenic
1014986918 6:128022607-128022629 AAAATCTTCATTGATTTTGAAGG + Intronic
1015001093 6:128216563-128216585 AAAATTTTCAATGAAATTTAAGG + Intronic
1015065112 6:129015483-129015505 AAAATGTTTAATGTTTTTCATGG - Intronic
1015084433 6:129271783-129271805 AAAATTTTCAATGATCTTTAAGG + Intronic
1015198154 6:130546934-130546956 AAAATATGAAATGTTATTGAAGG - Intergenic
1015429121 6:133109790-133109812 AAAATATTTAAATATATTCAAGG + Intergenic
1015807190 6:137122210-137122232 AAAACCTGATATGATATTTAAGG + Intergenic
1016342355 6:143076969-143076991 TAAATATTAAAAAATATTCAAGG - Intronic
1016359968 6:143256953-143256975 GAAATCTTAAATGATATAATTGG + Intronic
1016535178 6:145102113-145102135 ATAAACTTAAATGATTTTAATGG + Intergenic
1016596466 6:145807835-145807857 AAAAACTAAAATAATAGTCACGG + Intronic
1017561913 6:155637119-155637141 AAAATATAAAATGATACTGAAGG + Intergenic
1018022962 6:159779617-159779639 AAAATCTAAAATGGTAAGCATGG - Exonic
1018327577 6:162689469-162689491 AAAGAGTTAAATGATTTTCAAGG - Intronic
1018517317 6:164598702-164598724 AACAACTTAAATTATATTTAAGG + Intergenic
1018583942 6:165335126-165335148 AAAATCTTTAAAAATATCCAAGG + Intronic
1018675138 6:166214244-166214266 AAAAACTAAAATGATAGTAAGGG + Intergenic
1020724191 7:11788550-11788572 AAAATTTTAAAAGATACTCTCGG - Intronic
1021269035 7:18562084-18562106 AAAATGTTGAGTGATTTTCAAGG + Intronic
1021350388 7:19586393-19586415 AAATTCTCAAATGATATTCCTGG - Intergenic
1021748035 7:23763509-23763531 AAAATTTTAAACAATATTAAAGG - Intronic
1022945865 7:35282838-35282860 TAAAACTTTAATGTTATTCAAGG - Intergenic
1023169522 7:37377245-37377267 AAAATCTTAAGTTGAATTCAGGG + Intronic
1023431563 7:40097447-40097469 AAAATATTAAATGCTATGAAGGG - Intergenic
1024149058 7:46550609-46550631 AGATTCTTAAATGATTTTTAAGG - Intergenic
1024382353 7:48712250-48712272 AAACTTTCAAATGATATTTAAGG - Intergenic
1024575007 7:50756168-50756190 ACACTCTTAAATGATCTTCTTGG - Intronic
1024902229 7:54333162-54333184 AAAACCTTTAAAGAAATTCAAGG - Intergenic
1024902576 7:54337545-54337567 AAAATTTTAAATGCTTTTAATGG - Intergenic
1025145653 7:56500340-56500362 AAAATTTAAAATGAAGTTCAAGG + Intergenic
1025837381 7:65107453-65107475 AAAATTTTAAATTATACTAATGG - Intergenic
1025885693 7:65588555-65588577 AAAATTTTAAATTATACTAATGG + Intergenic
1027539399 7:79449801-79449823 AAACTGTTTAATGAAATTCAAGG - Intronic
1027591637 7:80126210-80126232 AAAATTTAAAATGATTTTCCTGG - Intergenic
1027702143 7:81482819-81482841 TAAATCTTAAACTTTATTCAAGG - Intergenic
1027873373 7:83738850-83738872 AAAATAGGAAATAATATTCATGG - Intergenic
1027881147 7:83838712-83838734 AAAAGATAAAATTATATTCAGGG + Intergenic
1027978005 7:85184129-85184151 AAAATTTTAAATGCAATTCATGG - Intronic
1028006560 7:85577579-85577601 TAAATCTTACATCAAATTCATGG + Intergenic
1028032896 7:85939932-85939954 AAAATTTTAAATTATAATGAAGG + Intergenic
1028441410 7:90866717-90866739 AAAACCTAAAATGTCATTCATGG - Intronic
1029309617 7:99650493-99650515 AAACACTAAAATTATATTCAGGG + Intronic
1029321134 7:99761240-99761262 AAACACTGAAATTATATTCAGGG + Intronic
1030412563 7:109200046-109200068 AAATTGTTACAAGATATTCAGGG - Intergenic
1030443579 7:109620655-109620677 AAAATTTTAAATGAAATTTGAGG + Intergenic
1030447792 7:109669186-109669208 ATAATGTTAAATGGTATTCATGG - Intergenic
1030574234 7:111266117-111266139 TAAATATTACATTATATTCAAGG - Intronic
1030806372 7:113924879-113924901 AAGAACTTAAATGATTTCCAAGG - Intronic
1030857540 7:114580077-114580099 AAAATCTTACAGAATATTTAAGG - Intronic
1031420701 7:121548848-121548870 AGAATCTTAAATCAAATGCAGGG + Intergenic
1031569210 7:123337320-123337342 AAAATATGAAAAGATATACAAGG - Intergenic
1031645177 7:124217328-124217350 AAAATATTTAATTATATTTAAGG - Intergenic
1032244652 7:130199547-130199569 AAAATCTTAAAAGATATGTCAGG - Intronic
1032427985 7:131837299-131837321 AATATCTTAATTAATATGCATGG - Intergenic
1032623657 7:133564720-133564742 CAAATCTTAAAAAATATTAAGGG - Intronic
1032960141 7:137023317-137023339 AAAATAATAAATAATAATCATGG - Intergenic
1033718219 7:144025477-144025499 GAAATCATCACTGATATTCATGG - Intergenic
1033834264 7:145289848-145289870 AAAACCTTAAGTGCTATTTAGGG - Intergenic
1035431062 7:158822327-158822349 AAAGTCTTAACTGTGATTCAAGG - Intronic
1035670200 8:1411325-1411347 AAAATCTTATATGGTTTTGAAGG + Intergenic
1036057859 8:5279781-5279803 TTATTCTTAAATGATTTTCATGG - Intergenic
1036141275 8:6211259-6211281 AAAATCTTAAATGGTATTTATGG - Intergenic
1036759532 8:11497646-11497668 AAAACCTTAAATGAAAATCAAGG + Intronic
1037047198 8:14321982-14322004 TAAATAGTAAATGACATTCATGG + Intronic
1037113215 8:15191463-15191485 AAAATCTTAAATTGTTTTCAGGG - Intronic
1037387109 8:18354919-18354941 AAAATCTTAAAAGAAGTTGAGGG - Intergenic
1038080068 8:24124632-24124654 AAAATCTTAAAAAAAATACAAGG - Intergenic
1038119842 8:24600880-24600902 AAAATCTTCAAAGATTTTTATGG + Intergenic
1038314904 8:26476077-26476099 TAAATCTTATCTGATTTTCAAGG - Intronic
1038684085 8:29699819-29699841 ATAATTTTAAATTAAATTCAAGG - Intergenic
1038838085 8:31150975-31150997 AAAATCCTAAATGACATTTCTGG - Intronic
1039070745 8:33647377-33647399 ATAATCCTAAATAATATTCTTGG + Intergenic
1039417894 8:37411164-37411186 AAAACCATAAATGTTTTTCATGG - Intergenic
1039899564 8:41741413-41741435 AAAATCTTAAAAGTTCTTGAAGG - Intronic
1040045564 8:42960057-42960079 AAAATCTGAAATGCAATTAATGG - Intronic
1040572249 8:48621439-48621461 CAAATCTTAGTTTATATTCAAGG + Intergenic
1041911948 8:63098112-63098134 AAAATCTTGCATTATGTTCATGG + Intergenic
1042322349 8:67489852-67489874 AAAATTTTAAATGATGTTAATGG - Intronic
1042606191 8:70549064-70549086 AAAAGTTTAAATCAAATTCATGG + Intergenic
1042692535 8:71517362-71517384 AATATTTTAAAAGATTTTCATGG - Intronic
1042894308 8:73650247-73650269 AAAAATTTAAATGATTTCCAAGG - Intronic
1043406286 8:79937310-79937332 AAAATTTTACGTGATTTTCAAGG - Intronic
1043834135 8:85027213-85027235 AAAAGCCTGAATGATATTGAGGG + Intergenic
1044014099 8:87029696-87029718 AAAGTCTTAAATAATATTTGAGG + Intronic
1044562865 8:93630434-93630456 ACCTTTTTAAATGATATTCATGG - Intergenic
1044862759 8:96539469-96539491 AAATTATTAAATTATATTAAAGG + Intronic
1044881784 8:96730595-96730617 AAAATCTTTTATGATCTTAAAGG + Intronic
1045230877 8:100305560-100305582 AAAATTTTAAATTATATTTGTGG + Intronic
1045454195 8:102359787-102359809 AAAATTTTAAATGAAATAAATGG + Intronic
1045758290 8:105571910-105571932 AAAACCTTATATGATAATAAAGG - Intronic
1045894212 8:107194748-107194770 AGAACCTTGAATGATATTTAAGG - Intergenic
1046004902 8:108467287-108467309 AAAATTTTAAACAATATACAAGG - Intronic
1046176881 8:110587756-110587778 AAAATAATAATTCATATTCATGG + Intergenic
1046482030 8:114834519-114834541 AAAATTTTTAATGTTATTCTTGG + Intergenic
1046997135 8:120535786-120535808 TAAATTTTACATAATATTCATGG + Exonic
1047098259 8:121647601-121647623 AAAAACTCAAATAATATTCAGGG - Intergenic
1047872192 8:129096339-129096361 ATAATATTAAAAGATATACAAGG + Intergenic
1047880607 8:129188667-129188689 AAAGGCTTAAATAATATTAAAGG - Intergenic
1047911093 8:129530305-129530327 AAACATTTAAATGATATTTATGG + Intergenic
1048109043 8:131446547-131446569 AAAATCTAAAAACATATTCAAGG - Intergenic
1048246804 8:132812570-132812592 AAAATCTAAAATAATTTACAAGG - Intronic
1050633554 9:7585631-7585653 ATAATCTTAAATGGTGTTTATGG - Intergenic
1050669750 9:7982596-7982618 AAAATTTTAAATTTTATTCGTGG + Intergenic
1050778472 9:9299332-9299354 AACATATTTAATGATTTTCAAGG + Intronic
1051427545 9:16948560-16948582 AAAATCTTAGATGTGCTTCAAGG - Intergenic
1052013202 9:23435221-23435243 AAAAGTTTGAATGATATTAATGG - Intergenic
1052116709 9:24657300-24657322 AAAATCTTCTTTGATATTAATGG + Intergenic
1052323915 9:27196811-27196833 AAAATGTTAAATAATTTCCATGG - Intronic
1052485552 9:29094819-29094841 ACATTTTTAAATTATATTCAAGG + Intergenic
1052872264 9:33519216-33519238 TAAATGTTAAATGGAATTCATGG - Intergenic
1052948702 9:34190201-34190223 AAAATCTTAAACAAAAATCACGG + Intronic
1053884527 9:42633580-42633602 GAAATATTAAAGGTTATTCAAGG + Intergenic
1053888141 9:42660656-42660678 GAAATATTAAAGGTTATTCAAGG - Intergenic
1054223548 9:62441025-62441047 GAAATATTAAAGGTTATTCAAGG + Intergenic
1054227161 9:62468106-62468128 GAAATATTAAAGGTTATTCAAGG - Intergenic
1054351398 9:64019992-64020014 AAAATATTAAAGATTATTCAAGG - Intergenic
1055160116 9:73116338-73116360 AAAATTATAAATGTAATTCATGG + Intergenic
1055277045 9:74629709-74629731 AAAATAATAAAGGATATTGATGG - Intronic
1055361741 9:75498301-75498323 AATCTCTCAAATGATTTTCAAGG - Intergenic
1055917380 9:81419079-81419101 TAAATCATAAATAATATTGATGG + Intergenic
1056027184 9:82511220-82511242 AAAATCTTAACTGTTATTGAGGG - Intergenic
1056431347 9:86531328-86531350 AAAATTTAAAATTATACTCATGG + Intergenic
1056478330 9:86974919-86974941 AAAATCCTATAAGATATCCAAGG - Intergenic
1057114922 9:92511829-92511851 AAAATAGTAAACTATATTCAAGG + Intronic
1057506458 9:95637714-95637736 AAAATCTAAAATTACATCCAGGG + Intergenic
1058050214 9:100398237-100398259 AAAATATAAAATGATATTTTGGG + Intergenic
1059754888 9:117283430-117283452 AAAAACGTGAATGATACTCATGG + Intronic
1059986633 9:119826353-119826375 TAATTCTTAACTAATATTCAAGG - Intergenic
1060314660 9:122498571-122498593 AAAAAGTTTAATGAGATTCAAGG - Intergenic
1060760485 9:126243713-126243735 AAAATAATACATCATATTCAAGG - Intergenic
1061818898 9:133212452-133212474 AAAAATTTAAATGATATAGAGGG + Intergenic
1062146326 9:134991751-134991773 AAAATCTCTTGTGATATTCAAGG + Intergenic
1203713479 Un_KI270742v1:120350-120372 AAAATATTAAGTGCTATTTATGG - Intergenic
1185664332 X:1752757-1752779 AAAATTCTAAAAGAAATTCAGGG + Intergenic
1185678643 X:1869818-1869840 TAAATCTAAAATCAGATTCATGG + Intergenic
1185945534 X:4371689-4371711 AAGTTCTAAAATGACATTCAAGG + Intergenic
1186330698 X:8529501-8529523 AAAATCACAAATGACATTTACGG + Exonic
1186586595 X:10881433-10881455 AAAATCTTAAATGTTTTAAAAGG + Intergenic
1186859169 X:13654231-13654253 AAAATTTTAAATCATATTTGTGG + Intronic
1188116285 X:26247761-26247783 AAAATGATAAATGATATGAAAGG - Intergenic
1188321175 X:28739032-28739054 AAGGTCTTAAATGGTGTTCAAGG + Intronic
1189523273 X:41792636-41792658 AAAATTTAAAATTATATGCATGG - Intronic
1189742350 X:44132838-44132860 AATACCTTAAATGTGATTCATGG - Intergenic
1190489392 X:50966135-50966157 AAAATCTTAAAAGAAATAAAAGG - Intergenic
1191207054 X:57845823-57845845 AAAATCCTCAATAAAATTCAGGG + Intergenic
1191966488 X:66764638-66764660 AAAATCAGCAAAGATATTCAGGG - Intergenic
1191995992 X:67095615-67095637 AAAATCTTACATGCAATTGAAGG - Intergenic
1192657967 X:73012210-73012232 TAAATCATAAATAAAATTCAGGG - Intergenic
1192674283 X:73178881-73178903 AAAATCTAACATGTTTTTCATGG - Intergenic
1192749507 X:73974417-73974439 AAAATCACAAATGATATGGAAGG - Intergenic
1192966978 X:76187714-76187736 AAAATCTTAAAAGAAAATCTAGG - Intergenic
1193213124 X:78831096-78831118 AACAACTTAAATGAAATTCCAGG - Intergenic
1193249190 X:79268054-79268076 AAAAGCTAAAATAAGATTCATGG - Intergenic
1194291670 X:92080481-92080503 ATGATCTCAAATGATATTGAAGG - Intronic
1194824827 X:98549055-98549077 ATAATCTAAAATGATCTTGAAGG - Intergenic
1194845784 X:98807575-98807597 AAAACCTTATATCAAATTCATGG + Intergenic
1194872618 X:99152064-99152086 AACATGTGAAATGATACTCAAGG + Intergenic
1194906996 X:99590117-99590139 AAAATGTGAAATGAAACTCAGGG + Intergenic
1195236732 X:102906657-102906679 TTAATCTTAACTGCTATTCAAGG + Intergenic
1195243366 X:102974830-102974852 AAAATCCTAAAAGAAATTCTAGG + Intergenic
1195523776 X:105861747-105861769 AAAAATTTAAATCAAATTCATGG - Intronic
1195881029 X:109592832-109592854 AACCTCCTAAATGATCTTCAAGG + Intergenic
1196297319 X:114013240-114013262 AAAATCTTAAAGGATATCTGTGG + Intergenic
1196895210 X:120329432-120329454 AAAATCTTTGTTAATATTCAGGG - Intergenic
1197965164 X:132052504-132052526 AAAATCTTAAACTATATCCATGG + Intergenic
1198195402 X:134355695-134355717 AAAATCTAATAGGATATCCAAGG + Intergenic
1198248923 X:134860442-134860464 AAAATTTTAAATAATATACAAGG + Intergenic
1199225679 X:145370303-145370325 AAAATCTTCTATCAAATTCAAGG + Intergenic
1199748991 X:150796602-150796624 AAAATCTACAAGGATATTGAAGG + Intronic
1200609187 Y:5305060-5305082 ATGATCTCAAATGATATTGAAGG - Intronic
1201361684 Y:13158263-13158285 AAAATTTGAACTGAGATTCATGG - Intergenic
1201559971 Y:15305492-15305514 AAAATTTAAAATTATTTTCATGG - Intergenic