ID: 1094469918

View in Genome Browser
Species Human (GRCh38)
Location 12:30794323-30794345
Sequence AAAAGGCATTTGGACAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094469918_1094469921 14 Left 1094469918 12:30794323-30794345 CCAGGGCTGTCCAAATGCCTTTT No data
Right 1094469921 12:30794360-30794382 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094469918 Original CRISPR AAAAGGCATTTGGACAGCCC TGG (reversed) Intergenic
No off target data available for this crispr