ID: 1094469997

View in Genome Browser
Species Human (GRCh38)
Location 12:30794836-30794858
Sequence TCCCGAAGGCTCTAATGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094469997_1094470000 26 Left 1094469997 12:30794836-30794858 CCATGACATTAGAGCCTTCGGGA No data
Right 1094470000 12:30794885-30794907 CATAGCGCCTTGTATTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094469997 Original CRISPR TCCCGAAGGCTCTAATGTCA TGG (reversed) Intergenic