ID: 1094470000 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:30794885-30794907 |
| Sequence | CATAGCGCCTTGTATTCTTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094469997_1094470000 | 26 | Left | 1094469997 | 12:30794836-30794858 | CCATGACATTAGAGCCTTCGGGA | No data | ||
| Right | 1094470000 | 12:30794885-30794907 | CATAGCGCCTTGTATTCTTTAGG | No data | ||||
| 1094469998_1094470000 | 12 | Left | 1094469998 | 12:30794850-30794872 | CCTTCGGGATATTTCTGTACAGT | No data | ||
| Right | 1094470000 | 12:30794885-30794907 | CATAGCGCCTTGTATTCTTTAGG | No data | ||||
| 1094469995_1094470000 | 27 | Left | 1094469995 | 12:30794835-30794857 | CCCATGACATTAGAGCCTTCGGG | No data | ||
| Right | 1094470000 | 12:30794885-30794907 | CATAGCGCCTTGTATTCTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094470000 | Original CRISPR | CATAGCGCCTTGTATTCTTT AGG | Intergenic | ||