ID: 1094470000

View in Genome Browser
Species Human (GRCh38)
Location 12:30794885-30794907
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094469997_1094470000 26 Left 1094469997 12:30794836-30794858 CCATGACATTAGAGCCTTCGGGA No data
Right 1094470000 12:30794885-30794907 CATAGCGCCTTGTATTCTTTAGG No data
1094469998_1094470000 12 Left 1094469998 12:30794850-30794872 CCTTCGGGATATTTCTGTACAGT No data
Right 1094470000 12:30794885-30794907 CATAGCGCCTTGTATTCTTTAGG No data
1094469995_1094470000 27 Left 1094469995 12:30794835-30794857 CCCATGACATTAGAGCCTTCGGG No data
Right 1094470000 12:30794885-30794907 CATAGCGCCTTGTATTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094470000 Original CRISPR CATAGCGCCTTGTATTCTTT AGG Intergenic