ID: 1094470209

View in Genome Browser
Species Human (GRCh38)
Location 12:30795946-30795968
Sequence TACCGCGGCGCTGGGTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094470209_1094470213 -5 Left 1094470209 12:30795946-30795968 CCGCAGGACCCAGCGCCGCGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1094470213 12:30795964-30795986 CGGTAGCCTTCTCTGAACTGCGG 0: 1
1: 0
2: 0
3: 6
4: 91
1094470209_1094470215 1 Left 1094470209 12:30795946-30795968 CCGCAGGACCCAGCGCCGCGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1094470215 12:30795970-30795992 CCTTCTCTGAACTGCGGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1094470209_1094470217 7 Left 1094470209 12:30795946-30795968 CCGCAGGACCCAGCGCCGCGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1094470217 12:30795976-30795998 CTGAACTGCGGCTCAGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1094470209_1094470216 4 Left 1094470209 12:30795946-30795968 CCGCAGGACCCAGCGCCGCGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1094470216 12:30795973-30795995 TCTCTGAACTGCGGCTCAGGCGG 0: 1
1: 0
2: 3
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094470209 Original CRISPR TACCGCGGCGCTGGGTCCTG CGG (reversed) Intergenic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
900641113 1:3688491-3688513 TCCTGCGGCCCAGGGTCCTGCGG + Intronic
903884163 1:26531351-26531373 GACCGGGGCGCAAGGTCCTGGGG + Intronic
907341336 1:53738327-53738349 CGCCGCGGCGCGGGGGCCTGGGG - Intergenic
907723618 1:56998112-56998134 TACAGAGGCTCTGGCTCCTGTGG + Exonic
922475999 1:225907374-225907396 AACTGGGGCTCTGGGTCCTGTGG + Intronic
923709841 1:236378428-236378450 TACCCCAGAGCTGGTTCCTGGGG + Intronic
1062890565 10:1056757-1056779 TCCCGCGCCGCTGGGTTCTCCGG - Intronic
1063824123 10:9875317-9875339 CACCGCGGCCCTGGGCCCTAGGG - Intergenic
1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG + Intergenic
1064151857 10:12872098-12872120 AACTGAGGGGCTGGGTCCTGAGG - Intergenic
1072336669 10:94403510-94403532 CGCCGCGGAGCAGGGTCCTGCGG + Exonic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1094470209 12:30795946-30795968 TACCGCGGCGCTGGGTCCTGCGG - Intergenic
1096773961 12:53953070-53953092 TAACGCGGGGCCGGCTCCTGGGG + Intergenic
1098416881 12:70243870-70243892 TGCCGCCGCGCTGCTTCCTGGGG + Intronic
1101649863 12:106667611-106667633 TACCACAGTACTGGGTCCTGAGG + Intronic
1105202276 13:18190827-18190849 TATCTTGGCACTGGGTCCTGTGG - Intergenic
1107143578 13:37032550-37032572 TACCCTGGCACTGGTTCCTGAGG - Intronic
1107605098 13:42048826-42048848 GACCGCGGCGCCGGCTCCGGCGG - Exonic
1114075118 14:19157710-19157732 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1114087151 14:19242272-19242294 AACCCCTGCGCTGGGCCCTGTGG - Intergenic
1117326483 14:54673639-54673661 TACCGAAGCCCTGGGTCCTGTGG + Intronic
1118892451 14:69921531-69921553 TCCTGGGGCTCTGGGTCCTGGGG + Intronic
1119889446 14:78172079-78172101 TTCCTCTCCGCTGGGTCCTGTGG + Intergenic
1122288701 14:100668001-100668023 CACGGCTGCTCTGGGTCCTGAGG - Intergenic
1123118084 14:105903721-105903743 GACAGCGGTGCTGCGTCCTGGGG + Intergenic
1126110775 15:45173563-45173585 GACAGCAGCGGTGGGTCCTGGGG - Exonic
1128245114 15:66127734-66127756 AGCTGCGGCGCTAGGTCCTGGGG - Intronic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1139199758 16:64962454-64962476 TACCCCAGCACTGGTTCCTGAGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1147973118 17:44230586-44230608 TACCCTGGCACTGGTTCCTGTGG + Intergenic
1149210086 17:54291614-54291636 TAACTCGGCGCTGGTCCCTGGGG - Intergenic
1152560770 17:81077808-81077830 CACCTCGGAGCTGGGTGCTGTGG + Intronic
1152560813 17:81077989-81078011 CACCTCGGAGCTGGGTGCTGTGG + Intronic
1152560869 17:81078214-81078236 CACCTCGGAGCTGGGTGCTGTGG + Intronic
1152560907 17:81078356-81078378 CACCTCGGAGCTGGGTGCTGTGG + Intronic
1157296424 18:46448212-46448234 TACAGAGGAGCTGGGTCATGTGG - Intronic
1160540406 18:79617495-79617517 TCCCGGGGGGCGGGGTCCTGGGG - Intergenic
1160548625 18:79679268-79679290 TCCCGCGGCGTGGGGTCCGGGGG + Intergenic
1161870522 19:6866218-6866240 TACCCCGGTACTGGTTCCTGAGG + Intergenic
926261551 2:11268181-11268203 TACCTCAGCACTGGTTCCTGTGG - Intronic
931719441 2:65056567-65056589 TGCCGCGGCGCTGGGGGCGGTGG + Intronic
936710102 2:115121843-115121865 TATAGGGGCACTGGGTCCTGAGG + Intronic
937959942 2:127449934-127449956 TACCCCGGTACTGGTTCCTGTGG + Intronic
947867988 2:233414618-233414640 TATCGTGGTCCTGGGTCCTGTGG + Intronic
1173363870 20:42368011-42368033 TACCCAGGCTCTGGGTGCTGCGG + Intronic
1176715671 21:10347181-10347203 TATCTTGGCACTGGGTCCTGTGG + Intergenic
1178109618 21:29357197-29357219 TAACGGGGCGCTGGTCCCTGGGG + Intronic
1178915006 21:36701178-36701200 TACCTCGGCACTGGCTCCCGGGG - Intronic
1180290767 22:10850619-10850641 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180493568 22:15880046-15880068 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180602672 22:17032772-17032794 TATCTTGGCACTGGGTCCTGTGG - Intergenic
954285944 3:49619285-49619307 AAGCGTGGCGCTGGGTCCTAAGG + Intronic
961182357 3:124886975-124886997 TACAGCGGCGCCGGGGCCCGCGG + Exonic
961312889 3:126015126-126015148 AACCGGGGCGCTGGCTCTTGTGG - Intronic
966807246 3:183817282-183817304 CCCCGCGGCAGTGGGTCCTGAGG + Exonic
968956269 4:3721389-3721411 TCCCGTGGGGCTGGGACCTGGGG + Intergenic
975741726 4:77435832-77435854 TACTGCTGCACTTGGTCCTGAGG + Intergenic
985997539 5:3605294-3605316 TATGGCAGTGCTGGGTCCTGTGG - Intergenic
997361658 5:133299151-133299173 TACAGAGGGGCTGGGGCCTGTGG + Intronic
1002927580 6:1614047-1614069 TGTCGCGGCGCTAGGTCCCGGGG + Intergenic
1004054603 6:12122832-12122854 TACAGAGTCGCTGGGTCCTCCGG + Exonic
1005361033 6:25030982-25031004 GACCCCGGCGCTGGGTGCAGTGG - Intronic
1031064888 7:117094259-117094281 TACCGCAGCCCTGGGGCCTGAGG - Intronic
1039276328 8:35936968-35936990 TAACTGGGCGCTGGTTCCTGGGG - Intergenic
1049564747 8:143332173-143332195 CAGCACTGCGCTGGGTCCTGCGG + Intronic
1052289873 9:26828494-26828516 TAACTGGGCGCTGGTTCCTGGGG - Intergenic
1058365681 9:104205958-104205980 TACCCCAGCACTGGTTCCTGCGG - Intergenic
1058686741 9:107487427-107487449 TACCCCGACCCTGGGTCTTGAGG - Exonic
1061805138 9:133133539-133133561 AGCCGAGGCGCTGGGGCCTGGGG + Intronic
1185451191 X:281231-281253 TACCGCGGCTCCGGGTCCCCAGG - Exonic