ID: 1094475750

View in Genome Browser
Species Human (GRCh38)
Location 12:30839450-30839472
Sequence TCATGTTGATGAGCCCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475750_1094475762 17 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475762 12:30839490-30839512 TGGTTCAGAAACGGGTTGTGTGG No data
1094475750_1094475759 8 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475759 12:30839481-30839503 GACTCCACGTGGTTCAGAAACGG No data
1094475750_1094475760 9 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475760 12:30839482-30839504 ACTCCACGTGGTTCAGAAACGGG No data
1094475750_1094475754 -3 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475750_1094475763 22 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475750 Original CRISPR TCATGTTGATGAGCCCTGAG GGG (reversed) Intergenic
No off target data available for this crispr