ID: 1094475754

View in Genome Browser
Species Human (GRCh38)
Location 12:30839470-30839492
Sequence TGAACCCCCAGGACTCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475749_1094475754 -2 Left 1094475749 12:30839449-30839471 CCCCCTCAGGGCTCATCAACATG No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475746_1094475754 19 Left 1094475746 12:30839428-30839450 CCAAAGGAGGAGGAAAGTTCACC No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475750_1094475754 -3 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475745_1094475754 28 Left 1094475745 12:30839419-30839441 CCTTGGGGGCCAAAGGAGGAGGA No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475752_1094475754 -5 Left 1094475752 12:30839452-30839474 CCTCAGGGCTCATCAACATGAAC No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data
1094475751_1094475754 -4 Left 1094475751 12:30839451-30839473 CCCTCAGGGCTCATCAACATGAA No data
Right 1094475754 12:30839470-30839492 TGAACCCCCAGGACTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475754 Original CRISPR TGAACCCCCAGGACTCCACG TGG Intergenic
No off target data available for this crispr