ID: 1094475755

View in Genome Browser
Species Human (GRCh38)
Location 12:30839474-30839496
Sequence TGAACCACGTGGAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475755_1094475762 -7 Left 1094475755 12:30839474-30839496 CCCCCAGGACTCCACGTGGTTCA No data
Right 1094475762 12:30839490-30839512 TGGTTCAGAAACGGGTTGTGTGG No data
1094475755_1094475763 -2 Left 1094475755 12:30839474-30839496 CCCCCAGGACTCCACGTGGTTCA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475755 Original CRISPR TGAACCACGTGGAGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr