ID: 1094475760

View in Genome Browser
Species Human (GRCh38)
Location 12:30839482-30839504
Sequence ACTCCACGTGGTTCAGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475752_1094475760 7 Left 1094475752 12:30839452-30839474 CCTCAGGGCTCATCAACATGAAC No data
Right 1094475760 12:30839482-30839504 ACTCCACGTGGTTCAGAAACGGG No data
1094475751_1094475760 8 Left 1094475751 12:30839451-30839473 CCCTCAGGGCTCATCAACATGAA No data
Right 1094475760 12:30839482-30839504 ACTCCACGTGGTTCAGAAACGGG No data
1094475750_1094475760 9 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475760 12:30839482-30839504 ACTCCACGTGGTTCAGAAACGGG No data
1094475749_1094475760 10 Left 1094475749 12:30839449-30839471 CCCCCTCAGGGCTCATCAACATG No data
Right 1094475760 12:30839482-30839504 ACTCCACGTGGTTCAGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475760 Original CRISPR ACTCCACGTGGTTCAGAAAC GGG Intergenic
No off target data available for this crispr