ID: 1094475763

View in Genome Browser
Species Human (GRCh38)
Location 12:30839495-30839517
Sequence CAGAAACGGGTTGTGTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475751_1094475763 21 Left 1094475751 12:30839451-30839473 CCCTCAGGGCTCATCAACATGAA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475749_1094475763 23 Left 1094475749 12:30839449-30839471 CCCCCTCAGGGCTCATCAACATG No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475757_1094475763 -4 Left 1094475757 12:30839476-30839498 CCCAGGACTCCACGTGGTTCAGA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475750_1094475763 22 Left 1094475750 12:30839450-30839472 CCCCTCAGGGCTCATCAACATGA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475756_1094475763 -3 Left 1094475756 12:30839475-30839497 CCCCAGGACTCCACGTGGTTCAG No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475758_1094475763 -5 Left 1094475758 12:30839477-30839499 CCAGGACTCCACGTGGTTCAGAA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475752_1094475763 20 Left 1094475752 12:30839452-30839474 CCTCAGGGCTCATCAACATGAAC No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data
1094475755_1094475763 -2 Left 1094475755 12:30839474-30839496 CCCCCAGGACTCCACGTGGTTCA No data
Right 1094475763 12:30839495-30839517 CAGAAACGGGTTGTGTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475763 Original CRISPR CAGAAACGGGTTGTGTGGCT AGG Intergenic
No off target data available for this crispr