ID: 1094475959

View in Genome Browser
Species Human (GRCh38)
Location 12:30840744-30840766
Sequence GGATGGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094475955_1094475959 3 Left 1094475955 12:30840718-30840740 CCACTTTTAATAATATGCAAGTT No data
Right 1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG No data
1094475954_1094475959 4 Left 1094475954 12:30840717-30840739 CCCACTTTTAATAATATGCAAGT No data
Right 1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094475959 Original CRISPR GGATGGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr