ID: 1094481562

View in Genome Browser
Species Human (GRCh38)
Location 12:30886242-30886264
Sequence CACTCTGAGCACCTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094481560_1094481562 -3 Left 1094481560 12:30886222-30886244 CCAAACTCAGGTTTTAAAGCCAC No data
Right 1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG No data
1094481556_1094481562 24 Left 1094481556 12:30886195-30886217 CCACAGTAGGTTTGTGAGACCGT No data
Right 1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG No data
1094481558_1094481562 5 Left 1094481558 12:30886214-30886236 CCGTGAGCCCAAACTCAGGTTTT No data
Right 1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG No data
1094481559_1094481562 -2 Left 1094481559 12:30886221-30886243 CCCAAACTCAGGTTTTAAAGCCA No data
Right 1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094481562 Original CRISPR CACTCTGAGCACCTGTACCC TGG Intergenic
No off target data available for this crispr