ID: 1094483618

View in Genome Browser
Species Human (GRCh38)
Location 12:30905751-30905773
Sequence CATCCCCCACTAGGGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094483614_1094483618 4 Left 1094483614 12:30905724-30905746 CCTTTTCTTGTGATTAAAATAAA No data
Right 1094483618 12:30905751-30905773 CATCCCCCACTAGGGGAACTTGG No data
1094483613_1094483618 25 Left 1094483613 12:30905703-30905725 CCTGTTGGGATTCTGAGAAAACC No data
Right 1094483618 12:30905751-30905773 CATCCCCCACTAGGGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094483618 Original CRISPR CATCCCCCACTAGGGGAACT TGG Intergenic
No off target data available for this crispr