ID: 1094486403

View in Genome Browser
Species Human (GRCh38)
Location 12:30928808-30928830
Sequence AACAATGATGTGATCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094486403 Original CRISPR AACAATGATGTGATCATGGC TGG (reversed) Intronic
908030551 1:59994742-59994764 AGCACTGATGTGATGATGGATGG + Intronic
908102822 1:60808869-60808891 AATAATAATGTGATCATTGTTGG - Intergenic
908644005 1:66257058-66257080 GACAATGGTATGATTATGGCAGG + Intronic
910074463 1:83261073-83261095 AATAATGATGTAAGAATGGCAGG + Intergenic
911781276 1:101882594-101882616 AACACTGATGTAAGCATGACAGG + Intronic
911944222 1:104085518-104085540 AACAATGATGGTATTAAGGCAGG - Intergenic
914910368 1:151780758-151780780 GAGAATGATGTGAACATGGGAGG + Intronic
917013292 1:170500005-170500027 AAGAAAGTTTTGATCATGGCAGG - Intergenic
918460233 1:184768821-184768843 TAAAATGATATGCTCATGGCAGG + Intergenic
918505731 1:185252099-185252121 AAAAATGATGAGTTCATGTCCGG - Intronic
922448886 1:225720520-225720542 AAGAATGATGTGAACCTGGGAGG + Intergenic
1063426628 10:5955393-5955415 AAAAATTATGTGACCCTGGCTGG - Intronic
1063428480 10:5967497-5967519 AGGAATGATCTGATCTTGGCCGG - Intronic
1063511877 10:6653408-6653430 AAGAAAGATGTGATCATGGTTGG - Intergenic
1063653691 10:7965533-7965555 AACAAAGATGGCAGCATGGCTGG - Exonic
1064410972 10:15103732-15103754 AAGTGTGAGGTGATCATGGCAGG - Exonic
1064463569 10:15557647-15557669 AAGAATGGTGTGTTCAGGGCTGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1066054552 10:31668267-31668289 AACCATGATGTGTTCAGAGCAGG - Intergenic
1066687468 10:37994408-37994430 AACACTGATGTAGACATGGCTGG + Intergenic
1067155994 10:43781890-43781912 AGCCATGATGTCACCATGGCCGG + Intergenic
1069716965 10:70527334-70527356 AAAAGTGCTGTGCTCATGGCTGG - Intronic
1069808131 10:71138648-71138670 AAGAATGAGGTGAGCCTGGCTGG - Intergenic
1073225165 10:101912096-101912118 GAAAATGATTTGAGCATGGCTGG + Intronic
1076784167 10:132741179-132741201 TGCAGTGATGTGATCATGGCTGG - Intronic
1078580271 11:12534212-12534234 AACAATGATTTGAACTGGGCAGG - Intergenic
1079302211 11:19288059-19288081 AAACATGCTTTGATCATGGCTGG - Intergenic
1080766204 11:35299551-35299573 AACAATGATCTGAACAAGCCAGG + Intronic
1081718966 11:45272654-45272676 AAATATGATTTGATCATGGAAGG + Intronic
1082218394 11:49602471-49602493 AAAAATCATGTGAAGATGGCTGG - Intergenic
1083403462 11:62440596-62440618 AACTAAGAAGTGATCATGACAGG - Intronic
1083728683 11:64641887-64641909 AACAAGGATGGGAGAATGGCGGG + Intronic
1086625946 11:88952849-88952871 AACAATTATGGGATAATGGATGG - Intronic
1087360735 11:97156518-97156540 AAGAATCTTGGGATCATGGCTGG + Intergenic
1090001619 11:122965554-122965576 TACAATGATGTGAGCATTCCAGG + Intergenic
1090446022 11:126765532-126765554 AACAATGTTCTGATAATTGCTGG + Intronic
1092450854 12:8600736-8600758 AAAAAGGATATGATCAAGGCCGG + Intergenic
1093683778 12:22032716-22032738 TGCAATGGTGTGATCTTGGCTGG - Intergenic
1094486403 12:30928808-30928830 AACAATGATGTGATCATGGCTGG - Intronic
1095635920 12:44433579-44433601 AATAATGCTGTGAGCATGGATGG - Intergenic
1096239644 12:49952906-49952928 ACCAATGATGAGATGATAGCTGG - Intronic
1097382729 12:58914652-58914674 AACCATGATGTCATCATATCAGG - Intronic
1098448032 12:70587688-70587710 GACACTGATGTGTTCATGGAAGG + Intronic
1098807304 12:75035911-75035933 AAGAATGAGTTAATCATGGCAGG - Intergenic
1098831794 12:75373203-75373225 AACAAAGTTGCCATCATGGCAGG - Intronic
1100970976 12:100069941-100069963 AACAATTATGGGGGCATGGCTGG + Intronic
1101730762 12:107425156-107425178 AACCATGAGGTCAGCATGGCAGG - Intronic
1101837889 12:108307790-108307812 AACAAGGAGGTGGTCCTGGCTGG + Intronic
1104615065 12:130260409-130260431 ATCAATGCTGTGTTCAGGGCGGG + Intergenic
1104934089 12:132355305-132355327 AACAATGGGGGGATCTTGGCTGG + Intergenic
1106044749 13:26128510-26128532 TACAGTGCTGTGATCTTGGCTGG - Intergenic
1107115279 13:36740125-36740147 AACAATGAAGGGATCATTGGTGG - Intergenic
1108747030 13:53406335-53406357 AAGAATGATTTGAGCAGGGCAGG + Intergenic
1110388139 13:74938864-74938886 TACCAAGATGTGAACATGGCCGG + Intergenic
1111209377 13:85056946-85056968 AATAATTATGTGATGAAGGCAGG - Intergenic
1117249815 14:53925644-53925666 AACACTGCTTGGATCATGGCTGG + Intergenic
1117278816 14:54218005-54218027 CATAATGCTGTGATCATTGCAGG - Intergenic
1119967987 14:78938454-78938476 AATTATGTTGTGATCATGGTGGG + Intronic
1120121923 14:80691315-80691337 AATAATGATGTGGTGATGGGGGG + Intronic
1120458163 14:84758893-84758915 AACAATGATGTGGTCTTGGCAGG - Intergenic
1127185856 15:56480025-56480047 AACAATAATGGGTTCCTGGCCGG - Intergenic
1128915136 15:71553047-71553069 AACAACGATTTCATCTTGGCAGG - Intronic
1130699974 15:86168209-86168231 AAGATTAATGTGATCATGGGGGG + Intronic
1131177763 15:90220663-90220685 GAAAATGATGTGAGCCTGGCCGG - Intronic
1132019141 15:98345467-98345489 TAAAATAATGTGAACATGGCCGG + Intergenic
1135284545 16:21182135-21182157 AAAAATGATGTCAGCATGGCTGG + Intergenic
1135355042 16:21762044-21762066 GTCACTGATGTGATCCTGGCGGG + Intergenic
1135453526 16:22578186-22578208 GTCACTGATGTGATCCTGGCGGG + Intergenic
1135651341 16:24209272-24209294 AACAAAGAGGTGATGGTGGCAGG - Intronic
1135904961 16:26503237-26503259 AACAATGATGTGTGAATAGCTGG - Intergenic
1135934180 16:26765348-26765370 AACAATGATGCCAGCATGGCTGG - Intergenic
1135971396 16:27074446-27074468 AGCAATGGTGTGGTCTTGGCTGG + Intergenic
1136612351 16:31373990-31374012 AACAAAGATGTTATTATGGCTGG + Intronic
1137496267 16:48971598-48971620 GACACTGCTGTGATCAGGGCTGG - Intergenic
1137777291 16:51066475-51066497 GCCAATGGTGAGATCATGGCGGG + Intergenic
1138261227 16:55624403-55624425 AAAAACGATGAGTTCATGGCTGG - Intergenic
1139376723 16:66503310-66503332 AACAAGGAAGAGAACATGGCAGG - Intronic
1139602720 16:67996413-67996435 GGCAATGATGTGATCTTGGCGGG + Intronic
1140788865 16:78370075-78370097 AGCAGTGGTGTGATCTTGGCTGG - Intronic
1141033384 16:80608559-80608581 GCCAATGATGTCATCACGGCTGG - Intronic
1145864258 17:28230076-28230098 AACACAGATGAGGTCATGGCAGG - Intergenic
1146133734 17:30300086-30300108 CACAATGATGTGATAGTGACTGG + Intergenic
1149007906 17:51824620-51824642 AACAAGGATGAGATCAGTGCTGG - Intronic
1150588648 17:66541162-66541184 AACAAAGATGTGACCATGAGGGG + Intronic
1150800198 17:68275683-68275705 AAAAATGAAGTTATCTTGGCTGG + Intronic
1152969942 18:152042-152064 AACAGTTATGTGACCATGCCTGG - Intergenic
1153052981 18:917713-917735 AACAATGAGGTCACCCTGGCAGG - Intergenic
1153497399 18:5713793-5713815 AGCAAGGATGGCATCATGGCAGG + Intergenic
1153821710 18:8837668-8837690 AACATGGATGTGATAATGGCAGG - Intergenic
1155454230 18:25994019-25994041 ACCCATGATGTGAGCATGCCTGG - Intergenic
1157401917 18:47395921-47395943 TGCAGTGGTGTGATCATGGCTGG + Intergenic
1158500990 18:58001691-58001713 TACAATGGTGTGATCATAGCTGG + Intergenic
1158795002 18:60835032-60835054 AATAAGGATAAGATCATGGCAGG + Intergenic
1158799191 18:60886304-60886326 CACCATGATGTGATAATGGCTGG - Intergenic
1158935527 18:62361160-62361182 AGCAATGAAGTGATCAGGGAGGG + Intronic
1160502498 18:79409172-79409194 AACAATGGTTTGATGATGGATGG - Intronic
1165086586 19:33352688-33352710 AAGAATGATGTGAACAGGCCGGG - Intergenic
1167345425 19:48942652-48942674 AGCAATGATGTGAAATTGGCTGG - Intronic
926363215 2:12109732-12109754 CACACTGGTGTGAGCATGGCTGG - Intergenic
929451125 2:42038140-42038162 AACAATAATCTGACCAAGGCTGG - Intergenic
930314295 2:49779075-49779097 AAAAATCATGTGATTAGGGCAGG - Intergenic
931022341 2:58062280-58062302 GAGAATGATGGGAGCATGGCTGG - Intronic
932604261 2:73154175-73154197 TACAATGGTGGGATCTTGGCTGG - Intronic
935651397 2:105385311-105385333 AAGAATGATGTGATCAGAGAAGG + Intronic
935665244 2:105506631-105506653 AAAAAGAATGAGATCATGGCTGG + Intergenic
937411796 2:121683027-121683049 AACAATGGTGAGATCATACCAGG + Intergenic
938309194 2:130275656-130275678 GACAAGGATGTGGTCATGGAAGG - Intergenic
938817782 2:134921648-134921670 AACAAAGAAGTGAAGATGGCCGG - Intronic
939825321 2:147008606-147008628 AAAAACGATGTGATCCTGGCAGG - Intergenic
939846893 2:147257610-147257632 AAATATGATGTGATAATGACTGG + Intergenic
942953295 2:181746384-181746406 GAAATTGATGTGATCATGTCTGG - Intergenic
943762180 2:191622036-191622058 AACAATGATGGGGTGTTGGCTGG + Intergenic
944148174 2:196528704-196528726 CACAATTATGTGGTCATGCCTGG + Intronic
948350237 2:237334137-237334159 AACTATGGTGAGATCAGGGCAGG + Intronic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
1169245760 20:4023260-4023282 AGCAAGGATGTGGTCTTGGCTGG + Intergenic
1169949486 20:11027474-11027496 AGCAATGAAGTAATTATGGCCGG + Intergenic
1170057009 20:12216728-12216750 AGCAATGATGTGGTCTTAGCTGG - Intergenic
1174333517 20:49840817-49840839 AAAAATCATTTGATCAAGGCTGG + Intronic
1174573168 20:51517987-51518009 AACCAAAATGTGATCATGGGGGG + Intronic
1174993792 20:55543236-55543258 AACAAAAACGTGCTCATGGCAGG + Intergenic
1175535267 20:59706572-59706594 AACACTAATGTGATCCAGGCAGG - Intronic
1176226036 20:64000039-64000061 GACAATGGTGTGAACCTGGCAGG - Intronic
1178020623 21:28404277-28404299 AACCAAGATGTTATCAGGGCTGG + Intergenic
1178506255 21:33165617-33165639 AACAAATATGTGATGATGACCGG - Exonic
1184942623 22:47780359-47780381 AACAATGGTGTGATGGTAGCAGG - Intergenic
949348391 3:3098699-3098721 TAGAAATATGTGATCATGGCCGG - Intronic
949579059 3:5368439-5368461 ATCAAAGAAGTGAGCATGGCAGG + Intergenic
951440344 3:22715489-22715511 ATCAAAGATGACATCATGGCTGG - Intergenic
952599438 3:35061812-35061834 ACCAAAGATGTGATGATGGCTGG + Intergenic
952621045 3:35342921-35342943 AACAATGATGTGGTCTCAGCTGG - Intergenic
953502678 3:43453267-43453289 AACAATGACGTGAACCTGGGTGG - Intronic
954069160 3:48130411-48130433 AACAATGAGATGATCGTGGTGGG + Intergenic
954165460 3:48753791-48753813 CACTATGCTGTGATCATAGCAGG + Intronic
954219542 3:49144607-49144629 ACCAATGATATGAAGATGGCAGG + Intergenic
955956472 3:64294991-64295013 AACAATGGTCTGCTCATTGCAGG - Intronic
957549253 3:81682405-81682427 TGCAGTGGTGTGATCATGGCTGG - Intronic
957680697 3:83429846-83429868 AGCAATGATGTGATCAGAGACGG - Intergenic
958185642 3:90115888-90115910 CCCAATGATGTGATGATAGCAGG - Intergenic
961504671 3:127362292-127362314 AAGGATGGTGTGATCTTGGCGGG - Intergenic
962203852 3:133419366-133419388 AACACTGAATTGATCCTGGCTGG - Intronic
966041158 3:175490068-175490090 AACAATGATCAGTTCATGGATGG + Intronic
967505024 3:190244069-190244091 GACAATGGTGTGAACCTGGCAGG + Intergenic
968378590 4:67954-67976 GACAATGGTGTGAACATGGGAGG - Intronic
969119341 4:4896266-4896288 AAAAGTGATGTGATGATGGAAGG + Intergenic
970599506 4:17629993-17630015 AACAAAGATATAATCATTGCAGG + Exonic
971140378 4:23918779-23918801 AATAATGATTTGATCATTCCAGG + Intergenic
971511786 4:27435684-27435706 GAGAATGATGTGAACATGGGAGG - Intergenic
975150752 4:71018214-71018236 AAGAATGATGTGAACCTGGGAGG - Intronic
977348457 4:95847891-95847913 AACAATGATCTGATCAGGCCTGG + Intergenic
979189998 4:117845082-117845104 AACAAGGATGTGGTCTTGGTTGG + Intergenic
980665578 4:135929333-135929355 AAAAATAATGAGATCATGTCAGG - Intergenic
980828763 4:138104418-138104440 AACAATGTTGACAACATGGCAGG + Intergenic
981256613 4:142668750-142668772 AAAAATAAAATGATCATGGCTGG + Intronic
985011257 4:185584465-185584487 AAGAATTATCTGATCACGGCCGG - Intergenic
986263150 5:6166707-6166729 AAGAATGAAGTGATCAGAGCAGG - Intergenic
986459346 5:7954279-7954301 AACGATGCTGTGATATTGGCAGG - Intergenic
986489015 5:8270443-8270465 CACCATGATGTCATGATGGCTGG + Intergenic
994797847 5:104329626-104329648 AAAAATAATGGGATCCTGGCAGG + Intergenic
998906249 5:146908614-146908636 AACAATGATGTGAGCCTTACAGG - Intronic
1003714521 6:8631692-8631714 AAAAATGATGAGAACAGGGCAGG + Intergenic
1009661223 6:66613607-66613629 AACAATGTGATTATCATGGCAGG - Intergenic
1010062084 6:71635146-71635168 AACCAGGAAGTGATCCTGGCAGG - Intergenic
1011177659 6:84583005-84583027 AAAAATGATTTGAAAATGGCGGG - Intergenic
1012241395 6:96877064-96877086 AACTAAGATGTGATAAAGGCCGG - Intergenic
1012255160 6:97022764-97022786 AAAAATTAGGTGATCAGGGCTGG - Intronic
1012279842 6:97315553-97315575 AACAAAGTTGTGATTATGCCTGG + Intergenic
1012973214 6:105753493-105753515 GAAAATGATGTGATGCTGGCAGG + Intergenic
1013667108 6:112360142-112360164 TATAATGCTGTGAACATGGCAGG + Intergenic
1014296154 6:119620489-119620511 AAAAATGAGGTGGTCATGGCCGG + Intergenic
1015029201 6:128573857-128573879 AACAATGAAGTGACAGTGGCAGG + Intergenic
1016005264 6:139083028-139083050 AACAATGATGTCAACCTTGCAGG + Intergenic
1016291628 6:142534344-142534366 ATCAATGATGTGAGAATGGTTGG - Intergenic
1016542944 6:145187276-145187298 AATAAAGATGTCAGCATGGCCGG - Intergenic
1018383592 6:163283261-163283283 AGGAATGTTGTGTTCATGGCTGG - Intronic
1018640088 6:165897582-165897604 TTCAATGATGGGATCATGGCAGG + Intronic
1019375107 7:686209-686231 AAGAATGGTGTGAACATGGGAGG + Intronic
1019542630 7:1558444-1558466 AACTATGAAGTGACGATGGCTGG + Intronic
1020056796 7:5123192-5123214 AACAATAAAGAGCTCATGGCTGG - Intergenic
1020171104 7:5845756-5845778 AACAATAAAGAGCTCATGGCTGG + Intergenic
1020185832 7:5958732-5958754 AGCAGTGGTGTGATCATGGCAGG + Intronic
1020297084 7:6766030-6766052 AGCAGTGGTGTGATCATGGCAGG - Intronic
1022231192 7:28414202-28414224 AAAATTAATGTGATCCTGGCTGG + Intronic
1023792786 7:43766751-43766773 TACAGTTATGTGACCATGGCAGG + Intronic
1024753193 7:52494783-52494805 TGCAATGGTGTGATCTTGGCTGG + Intergenic
1025969068 7:66305257-66305279 ACCTTTCATGTGATCATGGCAGG + Intronic
1026915495 7:74117619-74117641 AACTATGATGAGGTGATGGCTGG - Intronic
1027292163 7:76725938-76725960 AATAATGATGTAAGAATGGCAGG + Intergenic
1027648998 7:80841173-80841195 AACTTGTATGTGATCATGGCGGG - Intronic
1029329921 7:99844183-99844205 AACACTGTTTTGATCATGTCGGG - Exonic
1032774863 7:135101759-135101781 AACCATGATGGAATCAAGGCTGG - Intronic
1033324366 7:140365161-140365183 TAAAATGCTGAGATCATGGCAGG + Intronic
1034160513 7:148990937-148990959 AAGAATGATGTGAACCTGGGAGG + Intergenic
1035366139 7:158350138-158350160 AACAATCAGGTGAACATGCCAGG - Intronic
1036815068 8:11896269-11896291 AAAAATTAGCTGATCATGGCCGG + Intergenic
1038836048 8:31124973-31124995 AAAAATGCTGTGATAATTGCAGG + Exonic
1038879940 8:31598425-31598447 TATAATGCTGTGATCAGGGCTGG - Intergenic
1040865955 8:52049161-52049183 ATCAATGATGGGATCACAGCTGG - Intergenic
1041215094 8:55592617-55592639 AAGAATGATGTGAACCTGGGAGG - Intergenic
1042594348 8:70429925-70429947 TGCCATGGTGTGATCATGGCTGG + Intergenic
1042870287 8:73391968-73391990 AACAATGAGGTAATGAAGGCCGG + Intergenic
1043376672 8:79657305-79657327 AAAAATGAGCTGAGCATGGCTGG - Intronic
1043703038 8:83314279-83314301 AACAAGGGTGTGATGATAGCTGG + Intergenic
1043927632 8:86055792-86055814 AACAAAATTGGGATCATGGCTGG + Intronic
1044483829 8:92725880-92725902 AAAAATGATGTAGTCATGGAAGG - Intergenic
1044560715 8:93609267-93609289 AAAAATGATGTGACCATTGGTGG - Intergenic
1046617668 8:116495440-116495462 AAGAATAATGTGACAATGGCAGG - Intergenic
1047372237 8:124265731-124265753 AATAAAAATGTGAACATGGCTGG - Intergenic
1048557863 8:135498367-135498389 AAGAATTATGTGATCAGGTCTGG - Intronic
1051236420 9:15004576-15004598 AATAATGTTGTCATCTTGGCAGG + Intergenic
1052368767 9:27641662-27641684 AACAAAGTGGTCATCATGGCAGG + Intergenic
1053105083 9:35402369-35402391 AACAATGGTGTGAACCTGGGAGG - Intronic
1053184226 9:36001849-36001871 AAAGATGATCTGCTCATGGCTGG - Intergenic
1055550757 9:77430086-77430108 CACAATGACATGTTCATGGCTGG + Intronic
1055625569 9:78173903-78173925 ACCAATGATCTCATCATGGCTGG + Intergenic
1056083398 9:83120778-83120800 AAGAATGAGGTCATCCTGGCAGG - Intergenic
1056930908 9:90876230-90876252 TGCAATGGTGTGATCTTGGCTGG - Intronic
1057647829 9:96893702-96893724 AAAAATGATGAGTTCAAGGCCGG + Intergenic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1058837450 9:108871131-108871153 AACAATGATGGCATCATTGATGG + Intronic
1061945534 9:133906574-133906596 AACACTGATGAGACCATGGTTGG + Intronic
1203570648 Un_KI270744v1:126296-126318 GACAATGGTGTGAACATGGGAGG + Intergenic
1186025526 X:5306624-5306646 CAGTGTGATGTGATCATGGCAGG - Intergenic
1190606793 X:52151275-52151297 AAAAATGATGAGTTCATGGGTGG - Intergenic
1190765970 X:53475914-53475936 ACCAGTCATGTGATCATAGCTGG - Intergenic
1196576916 X:117329242-117329264 ATAAATGATGTTATCATAGCTGG + Intergenic
1197262389 X:124332981-124333003 AACAATGAAGTCCTCATGGACGG + Intronic
1198128883 X:133674463-133674485 AGCAATGATGTGTGAATGGCTGG + Intronic