ID: 1094486879

View in Genome Browser
Species Human (GRCh38)
Location 12:30932634-30932656
Sequence TGTGACTCCCTCACACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094486879_1094486884 27 Left 1094486879 12:30932634-30932656 CCTGTTTGTGTGAGGGAGTCACA 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1094486884 12:30932684-30932706 ATGGAACCGCAGCACATAGATGG 0: 1
1: 0
2: 0
3: 6
4: 107
1094486879_1094486882 8 Left 1094486879 12:30932634-30932656 CCTGTTTGTGTGAGGGAGTCACA 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1094486882 12:30932665-30932687 TGGAGATCTACTAAAACCTATGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094486879 Original CRISPR TGTGACTCCCTCACACAAAC AGG (reversed) Intronic
900161545 1:1226481-1226503 TGTTACGTCCTCACAAAAACGGG + Intronic
900620546 1:3585039-3585061 TGTCACTCACTCCCACACACAGG - Intronic
901765313 1:11496355-11496377 TGTCTCTCTCTCACACATACAGG - Intronic
915507596 1:156367467-156367489 TATGACTCCCTCAGACAGGCGGG + Intronic
916050574 1:161033719-161033741 TCTCACTCTGTCACACAAACTGG + Intronic
917337646 1:173941918-173941940 TGAGACTCCCTCTCAAAAAAAGG + Intronic
918064815 1:181092992-181093014 TGTGAATGTCTCACACCAACCGG + Intergenic
919072230 1:192770757-192770779 TGTGTCTTCCTCACAAAAAAGGG + Intergenic
919920467 1:202163928-202163950 TCTGTCTCCCCGACACAAACAGG - Intergenic
924620715 1:245658426-245658448 TGTCACTCCGTCACCCAGACTGG + Intronic
1066425898 10:35307492-35307514 TGTGACTCACTCACCCAACTGGG + Intronic
1066586528 10:36942759-36942781 AGGGACTGCCTCACTCAAACAGG + Intergenic
1068537391 10:58255415-58255437 TGTCACCCCCTCCCCCAAACTGG - Intronic
1070153505 10:73819512-73819534 TGTGCCTCCCTCACACTTACTGG + Exonic
1072221301 10:93329874-93329896 TCTGAGTACCTCACAAAAACTGG + Intronic
1072520779 10:96228109-96228131 TGAGACTCCATCTCAAAAACAGG - Intronic
1072841037 10:98774032-98774054 TGTCACTCCGTCACCCATACTGG - Intronic
1076677592 10:132155456-132155478 TGTGAGTTCCTCACACAGAGGGG + Intronic
1081556863 11:44172314-44172336 TGTGATTCCTTCACACAAGGAGG - Intronic
1081720179 11:45283116-45283138 TCTGACTCCATCACACAGGCTGG - Intronic
1081977494 11:47244951-47244973 TCTCCCTCCCTCACACACACAGG - Intronic
1082812734 11:57488494-57488516 TGTTACTCCATCACATACACAGG + Intronic
1082843274 11:57706701-57706723 TCTCACTCTCTCACCCAAACTGG - Intronic
1084978374 11:72815473-72815495 GGTGACCCCCTCCCTCAAACTGG - Intronic
1085314486 11:75536128-75536150 TGTCACTCCATCACACAGGCTGG - Intergenic
1085363473 11:75914876-75914898 TGTGACACTCCCACACAAAAAGG - Intronic
1090123171 11:124054836-124054858 TGGGAATCCCTCATACAAAGGGG + Intergenic
1090259556 11:125308787-125308809 TAGGACTCCCTCACATAAAGGGG + Intronic
1091805954 12:3355975-3355997 TGTGACTCCCTCACTCAAAAAGG + Intergenic
1094131630 12:27081365-27081387 TGACACTCCTTCACACACACAGG - Exonic
1094486879 12:30932634-30932656 TGTGACTCCCTCACACAAACAGG - Intronic
1095639001 12:44465725-44465747 TGTGACCACTTCAGACAAACAGG + Intergenic
1097125083 12:56768080-56768102 TGTGACTCCCTGTCACCCACAGG - Intronic
1102187965 12:110964631-110964653 TGTGACTCTCTCACACCATCAGG - Intergenic
1104655578 12:130571844-130571866 TGTGGCCCCCTCACACACCCAGG + Intronic
1106413457 13:29526696-29526718 TGTGTCTTCCTCACGCAGACAGG + Intronic
1107258214 13:38456626-38456648 TCTCACTCCATCACCCAAACTGG + Intergenic
1107389986 13:39953717-39953739 TGTGTCTCCCTGACAAATACTGG + Intergenic
1107872853 13:44763026-44763048 AGTGACTCACTCACACAGAGTGG - Intergenic
1111944840 13:94654217-94654239 TCTTACTCTCTCACACAGACTGG + Intergenic
1113892511 13:113743884-113743906 TGGGCCTCCCTCACACACACAGG - Intergenic
1116778216 14:49205814-49205836 TGTGACTCCATCTCAAAGACCGG - Intergenic
1117222877 14:53623720-53623742 TGGGTCTCTCTCACACAAAATGG + Intergenic
1117369720 14:55066110-55066132 TGTGAATTTCTCAGACAAACAGG + Exonic
1120208990 14:81615728-81615750 TGTGACTCCCACCCAAGAACTGG - Intergenic
1124895068 15:33768777-33768799 TGTGTCTTCCTCAGACAACCCGG + Intronic
1127627856 15:60797853-60797875 AGGGACTTGCTCACACAAACTGG + Intronic
1128840952 15:70851714-70851736 TGTGTCTCCCTCACAGGAATAGG - Intronic
1129800361 15:78409299-78409321 TGTTACTGCCTGGCACAAACTGG + Intergenic
1132348157 15:101121066-101121088 TGTGACTCCCTCAGCCAGATGGG - Intergenic
1133574970 16:7080191-7080213 TGTGACTCCCAAAAACAAATGGG - Intronic
1134557923 16:15182191-15182213 CGTGACTCCACCACACAAAGAGG - Intergenic
1134918459 16:18093794-18093816 CGTGACTCCACCACACAAAGAGG - Intergenic
1135766531 16:25182177-25182199 TCTCACTCTGTCACACAAACCGG - Intergenic
1136872337 16:33818956-33818978 TGTGACTCTGTCACCCAAGCTGG - Intergenic
1137238955 16:46638573-46638595 TGAGGCTCCCTCAGACAAAAGGG - Intergenic
1140320555 16:73947292-73947314 TGTGACTTCCTCAAAAAAGCAGG + Intergenic
1142118880 16:88376338-88376360 TCTGACTCCTTCACACAGCCGGG + Intergenic
1142426523 16:90004546-90004568 TGTGACTCCCTCCCCCAGCCTGG + Intergenic
1142426538 16:90004601-90004623 TGTGACTCCCTCCCCCAGCCTGG + Intergenic
1203099835 16_KI270728v1_random:1297112-1297134 TGTGACTCTGTCACCCAAGCTGG + Intergenic
1148243692 17:46016359-46016381 TCTCACTCCCTCACCCAAGCTGG - Intronic
1150503455 17:65673904-65673926 TGTCACTCCATCACCCAAGCTGG + Intronic
1156661217 18:39348924-39348946 TGTGAGTTCCTTACACAGACAGG + Intergenic
1159053683 18:63444700-63444722 TTTGACTCACTCAGACATACTGG - Intergenic
1159872245 18:73771513-73771535 TGAGATGCCCTCACACACACTGG + Intergenic
1161652854 19:5496110-5496132 TGTGACTCCCTCAGGCAATCGGG + Intergenic
1162079042 19:8208238-8208260 TTTGATTTCCTCACACAGACAGG - Intronic
1164762467 19:30738276-30738298 TGTGCCTCCCTCCCACACATAGG + Intergenic
1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG + Intergenic
1166024084 19:40064131-40064153 TGTGTCTCACACACACAAAATGG - Intergenic
1166659547 19:44637378-44637400 TGTCACTCCCTCACCCAGGCTGG - Intergenic
1168208201 19:54868323-54868345 TGTGACTCCCTTACATCTACAGG + Intergenic
925632013 2:5904167-5904189 TATGTCTTGCTCACACAAACTGG - Intergenic
927847121 2:26477355-26477377 TGTGACACCTTCTCACAACCAGG + Intronic
930388514 2:50729873-50729895 TGTGGATCCCTCACACTCACAGG + Intronic
930618062 2:53614646-53614668 TGTGGATCTCTCACAGAAACTGG - Intronic
931660881 2:64561265-64561287 TGTGACTGAGTCACATAAACTGG + Intronic
932016731 2:68036154-68036176 TGAGAGTCCCTCACACCAGCAGG - Intergenic
934913819 2:98281843-98281865 TGGGACTTCCTCACTGAAACTGG + Intronic
935194367 2:100803546-100803568 TATGACTCCCACACCCACACAGG + Intergenic
941047138 2:160689545-160689567 TCTGACTCCCAAACACAACCTGG + Intergenic
944410095 2:199432016-199432038 CGTGAATCCCTCACACAAGAAGG + Intronic
944917926 2:204380203-204380225 AGGGACTACCTCACACATACTGG - Intergenic
945518144 2:210788707-210788729 GGTGTCTCCCTCACACAGAAAGG - Intergenic
947639782 2:231700747-231700769 TGGGAATCCCTCAGTCAAACAGG + Intergenic
949076505 2:242062196-242062218 TGAGACTCCATCACACACAGTGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1180993504 22:19952919-19952941 TGTCACTCTGTCACACAGACTGG - Intronic
1184695417 22:46136138-46136160 TGTTACTCCCTCGGACAATCAGG - Intergenic
950028722 3:9837980-9838002 CCTGACCCCCTCACACACACTGG - Exonic
951228657 3:20150422-20150444 TGTGACTCCCTAAGTAAAACAGG - Intronic
955476463 3:59341322-59341344 TGTGACACTCAAACACAAACAGG - Intergenic
958743770 3:98108965-98108987 TCTCACTCCATCACCCAAACTGG - Intergenic
963413560 3:144963369-144963391 TCTCACTCCGTCACCCAAACTGG - Intergenic
963892922 3:150656027-150656049 TGTCACTCTGTCACACAAGCTGG - Intergenic
965277219 3:166700912-166700934 TGTGAGTTCCTCACACATACTGG + Intergenic
969684393 4:8662386-8662408 TGAGACTCCGTCTCAAAAACAGG + Intergenic
975760509 4:77615045-77615067 TGTGATTCTCTTACACCAACTGG - Intergenic
979275049 4:118806093-118806115 TCTCACACACTCACACAAACTGG + Intronic
979451214 4:120873029-120873051 TCTTACTCCATCACCCAAACTGG + Intronic
982578758 4:157151816-157151838 TGTGAGTCCATCTCACATACTGG - Intronic
986136875 5:4988214-4988236 TGTGACCCCCTAACACAGAGAGG + Intergenic
986519895 5:8604115-8604137 TCTGACTCCCACATACGAACTGG - Intergenic
987103631 5:14615532-14615554 TGTGACTCCCTTAAATAAAAAGG + Intergenic
988306140 5:29497089-29497111 TGTGGTTGCTTCACACAAACTGG + Intergenic
989788341 5:45359151-45359173 TCTGACTCTATAACACAAACTGG - Intronic
999748587 5:154609991-154610013 TGTTCCTGCCACACACAAACTGG + Intergenic
1001285676 5:170421768-170421790 TGTGTCTTCCTCACTCAAATTGG + Intronic
1002870186 6:1160099-1160121 TCTGCTTCCCTCACACAAATTGG + Intergenic
1003144870 6:3501540-3501562 TGGGACTCCTTCACATAAACAGG - Intergenic
1007919443 6:45593202-45593224 GGTGACTACCACACACATACAGG + Intronic
1009603965 6:65842061-65842083 TTTGACTACATCACACAAAGTGG - Intergenic
1011358786 6:86500004-86500026 CATGACTCCCTCACTCAATCTGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1018277772 6:162151275-162151297 TTTGGCTCCATCAGACAAACAGG + Intronic
1020055302 7:5113808-5113830 CGTGAGTCCCTCACTCCAACCGG + Intergenic
1025725476 7:64054049-64054071 TGTGCCTCCCTCACAGAGCCTGG - Intronic
1026647829 7:72187842-72187864 TGTGACTCCCATACAGATACAGG - Intronic
1027649438 7:80847169-80847191 TCTGTCTCCCTCATCCAAACTGG - Intronic
1029239731 7:99151067-99151089 CATCCCTCCCTCACACAAACCGG - Intergenic
1031362728 7:120866507-120866529 TGTCTCTCTCTCACACACACAGG - Intergenic
1031556296 7:123180691-123180713 AGTGCCTCCCTCTCAAAAACAGG - Intronic
1031670761 7:124542046-124542068 TGTGACTAGCTCAGACAAACAGG + Intergenic
1032833309 7:135651100-135651122 TGGGACTGCGTCCCACAAACTGG - Intergenic
1036952100 8:13150494-13150516 TGTGACTCCCTGGTACAGACAGG + Intronic
1038783926 8:30593520-30593542 TGTGGCTCCGTCACCCAAACTGG + Intronic
1039694781 8:39899184-39899206 TCTCACTCCCTCACCCAAGCTGG + Intergenic
1041039751 8:53835116-53835138 TCTCACTCTGTCACACAAACTGG - Intronic
1042442440 8:68843884-68843906 TTTGACTCCCTCAGTCAAATTGG + Intergenic
1043013218 8:74906180-74906202 TCTGTCTCCCTTACACAGACAGG + Intergenic
1043734794 8:83729716-83729738 TGTGTCTCCCTCACATACCCTGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1049227655 8:141465466-141465488 AGTGACTCCCGCACACACACAGG - Intergenic
1049813424 8:144586590-144586612 TGTGACTCCTTCACAGACACTGG + Intronic
1051411984 9:16799342-16799364 TCTCACTCTCTCACCCAAACTGG + Intronic
1054710405 9:68505323-68505345 TGTGATTCCCTGACACCAACTGG + Intronic
1056496587 9:87161382-87161404 GGTGACTCCCTTTCACAATCTGG + Intergenic
1057581432 9:96290802-96290824 TCTCACTCTGTCACACAAACTGG - Intronic
1058339355 9:103875180-103875202 TGTCACTCTCTTACACAAGCTGG - Intergenic
1058478277 9:105363492-105363514 TGTCTCTCTGTCACACAAACTGG + Intronic
1061566074 9:131441237-131441259 TCTGACTCCCTCAAAAAAACTGG - Intronic
1187228848 X:17401516-17401538 TGTGACTACTTACCACAAACTGG + Intronic
1188717273 X:33476085-33476107 TGTGAGTCACTCTCACAGACAGG + Intergenic
1189762198 X:44333090-44333112 AGTGCCTTCCTTACACAAACCGG - Intronic
1190226698 X:48551633-48551655 TGAGACTCCCTCTCAAAAAAAGG - Intronic
1194258950 X:91670410-91670432 TCTGAGTCTCTCACACCAACTGG - Intergenic
1195170108 X:102259249-102259271 TGTGACTCCCTTACACTCAACGG - Intergenic
1195188749 X:102427851-102427873 TGTGACTCCCTTACACTCAACGG + Intronic
1196637702 X:118022204-118022226 TGTGACACACACACACAAATGGG - Intronic
1196851927 X:119946160-119946182 TCTGGCTCCCTCACCCAGACTGG + Intergenic
1197933920 X:131721389-131721411 TGAGACTCCCTCTCAAAAAAAGG - Intergenic
1200577654 Y:4909607-4909629 TCTGAGTCTCTCACACCAACTGG - Intergenic
1201103672 Y:10747509-10747531 TCTCACTCTCTCACACAGACTGG + Intergenic
1201641861 Y:16188089-16188111 TGTGACTTCCACACAGAAACTGG - Intergenic
1201660954 Y:16397232-16397254 TGTGACTTCCACACAGAAACTGG + Intergenic