ID: 1094487491

View in Genome Browser
Species Human (GRCh38)
Location 12:30936643-30936665
Sequence GTGAGCACTGCATAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094487491 Original CRISPR GTGAGCACTGCATAGGTGGA TGG Intronic
901968306 1:12886285-12886307 GCTAGCAGTGCATACGTGGAGGG - Intronic
901990400 1:13108217-13108239 GCAAGCACTGGATAGATGGAGGG - Intergenic
901997647 1:13166000-13166022 GCTAGCAGTGCATACGTGGAAGG - Intergenic
902016867 1:13315498-13315520 GCTAGCAGTGCATACGTGGAGGG + Intronic
902219484 1:14955825-14955847 CTGAGCACTGCACAGGAGGGAGG - Intronic
902784963 1:18726996-18727018 GTGAGCACTGCACATGTATAGGG - Intronic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
915573421 1:156758897-156758919 GGCAGCAGTGCAGAGGTGGAAGG + Intronic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
920186750 1:204164198-204164220 GTGAGCACTGGGTAAGAGGATGG - Intronic
920283373 1:204860714-204860736 GTGACCACTTCATTGGTAGAGGG - Intronic
922959981 1:229637999-229638021 GTCAGCACTGCAGGGATGGAGGG + Exonic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923545510 1:234920412-234920434 GTGAGCTCTGCATGAATGGAAGG - Intergenic
923669276 1:236026135-236026157 GTGATCACTGCAGAGTGGGAAGG + Exonic
1063811923 10:9721331-9721353 GTGAGCACTGCGTAGTTACAAGG + Intergenic
1063988867 10:11537743-11537765 GTGAGCACTGCCGGGGTGGAAGG + Intronic
1065750156 10:28878663-28878685 GTGAGCACTGTGTTGGGGGAGGG + Intronic
1066585578 10:36930764-36930786 GTGATGACAGAATAGGTGGAGGG - Intergenic
1067183537 10:44008008-44008030 GGGAGCATTTCAAAGGTGGAAGG + Intergenic
1067566885 10:47346016-47346038 GTGAGAACTGAATAGGTGAGTGG - Intergenic
1068718207 10:60211683-60211705 GTGTGCACTGCAAAGGTTGGTGG + Intronic
1070582481 10:77732684-77732706 GTGATCCCTGCATTGGTGGGAGG - Intergenic
1072253544 10:93600552-93600574 GGGAGCACCGAATGGGTGGAGGG - Intronic
1075393147 10:122107772-122107794 GTGTACACTGCTTAGGTGGCAGG - Intronic
1076119327 10:127922954-127922976 GTGACCTCAGCATTGGTGGAGGG + Intronic
1076223198 10:128751420-128751442 GTGAGCTATGCAGAAGTGGAGGG + Intergenic
1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG + Intergenic
1076454234 10:130578349-130578371 GTGCTCTCTGCCTAGGTGGAGGG - Intergenic
1079419105 11:20269485-20269507 GGCAGCACTGAATTGGTGGAGGG - Intergenic
1079547874 11:21656884-21656906 GGGAACACAGCATAGGTGGGCGG + Intergenic
1084809506 11:71603688-71603710 GTGGACACTGCAGGGGTGGAAGG + Intergenic
1085720088 11:78904884-78904906 GTGAGCATAGCTTAGATGGATGG - Intronic
1088820200 11:113450040-113450062 GTGAACATTGCATTCGTGGAGGG - Intronic
1089406852 11:118204594-118204616 GTGAACCCTGCATATGTGTAGGG - Intronic
1089614153 11:119685769-119685791 GTGAGCAGAGCAAAGGTGGCAGG - Intronic
1089639481 11:119838332-119838354 GTGTGCACTGCAAAGGTCGAGGG - Intergenic
1090331193 11:125933425-125933447 GTGAGCAGGGCATGGCTGGAGGG - Intergenic
1091237531 11:134032076-134032098 GTGAGCCATGCTTGGGTGGAAGG + Intergenic
1091312873 11:134586898-134586920 GTGAGGGCTGCACAGGAGGAAGG + Intergenic
1093984847 12:25519208-25519230 TTTAGCAGTGCTTAGGTGGAGGG - Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1101148441 12:101863507-101863529 GTGGGCACAGCATAGGGGCAGGG + Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1102507156 12:113390822-113390844 GTGATAAATGGATAGGTGGACGG - Exonic
1102785960 12:115605009-115605031 GTGGGCAATGCATAGATGGATGG + Intergenic
1104822707 12:131687470-131687492 CTGGGCACTGCATAGGGGGAGGG - Intergenic
1104882499 12:132082335-132082357 GTTAGCACTGCCTCTGTGGAGGG + Intergenic
1106601867 13:31195211-31195233 ATGAGCAGTGGATAGATGGAAGG - Intergenic
1107922335 13:45221951-45221973 GAGAGAACTGCATGGTTGGAAGG - Intronic
1108609679 13:52071772-52071794 GTGGCCACTGCATGGGTGGCAGG + Intronic
1108672289 13:52703835-52703857 GTGATAACTGCATAGTGGGAAGG + Intronic
1109280742 13:60352129-60352151 GTGATTACTGAATAGGAGGATGG - Intergenic
1110323102 13:74182520-74182542 GTCACCTCTGCAGAGGTGGAGGG + Intergenic
1111250854 13:85599306-85599328 GTAAGAACTGCTAAGGTGGATGG - Intergenic
1111886912 13:94032872-94032894 GTGGGCACTGCATCTGTGGCAGG + Intronic
1112416333 13:99206264-99206286 GTGAGGACTCCAGAGGTGGGGGG + Intronic
1124610118 15:31202383-31202405 GTGGGCACTGGATGTGTGGAAGG - Intergenic
1127291471 15:57574842-57574864 GTGAGCACTCAATAGCTGCAGGG - Intergenic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1128389612 15:67174210-67174232 GTGATCAGTGCATGGGAGGAAGG - Intronic
1129556220 15:76512580-76512602 GTCAGCACTGCAGAAGTGGAGGG + Intronic
1131265510 15:90912992-90913014 GTGAGCCCTGCATATGAGGAAGG + Intronic
1131657576 15:94477533-94477555 GAGATCACTGAATAGGTAGATGG + Intronic
1132457194 16:30703-30725 GGGAGCACTGCAGTGATGGAGGG - Intergenic
1134201116 16:12199768-12199790 GTGACGAGTGCATATGTGGATGG + Intronic
1135970540 16:27068955-27068977 GTGAGCACCGTCTCGGTGGATGG + Intergenic
1138617068 16:58177092-58177114 GTGAGGACTTCATATGTGGTTGG - Intronic
1139626512 16:68193689-68193711 GTGAAATCTGCATATGTGGAGGG - Intronic
1141214666 16:82011827-82011849 GTCAGCATTGCTTGGGTGGATGG + Intergenic
1141641809 16:85346057-85346079 ATGAACAATGGATAGGTGGATGG + Intergenic
1142119571 16:88379342-88379364 GTGAGCTCAGCAGAGCTGGAAGG - Intergenic
1143266608 17:5642696-5642718 GGGAGCACAGGACAGGTGGAGGG - Intergenic
1145985603 17:29043923-29043945 GTGACCACTGCATATGTGGGTGG + Intronic
1146239410 17:31203240-31203262 ATGAGCACTGCATGTGTGGAGGG + Intronic
1146511492 17:33453118-33453140 GTGAGAATTGCAGAGGAGGAAGG - Intronic
1150336037 17:64331611-64331633 GGAAGCTCTGCATAGGTGGTGGG + Intronic
1150455739 17:65305159-65305181 GTGAGCACTGCAGGGAAGGAGGG + Intergenic
1152312599 17:79559987-79560009 GTGAACAGTGGATGGGTGGAAGG + Intergenic
1153948280 18:10035890-10035912 GTGAGCACTCCAGATATGGAAGG + Intergenic
1157463765 18:47926878-47926900 GTGATCACTGAATAAGAGGAAGG + Intronic
1160017506 18:75155722-75155744 GTGAGCTCAGCACTGGTGGAAGG + Intergenic
1161287445 19:3476311-3476333 GTGAAGACTGCATAGTTCGATGG + Intronic
1161983772 19:7643438-7643460 GTGGCCTGTGCATAGGTGGATGG + Intronic
1162531216 19:11237463-11237485 GTGAGCACGGAATAGCTGGGCGG + Exonic
1162741125 19:12774518-12774540 GTGAGTACTCCATAGATGAATGG + Intronic
1163164125 19:15483642-15483664 GTAAGCACAGCCTAGGTTGAAGG - Intronic
1163492749 19:17626508-17626530 GTGGTCACTGGATAGTTGGATGG - Intronic
1165947739 19:39454948-39454970 GTGGGCACTGCCTGTGTGGAAGG + Intronic
1166300854 19:41911482-41911504 TTTAGAACTGCACAGGTGGAAGG + Intronic
925384230 2:3450856-3450878 GTGAGCACGGGATAGGTTTAGGG - Intronic
927129980 2:20051019-20051041 GGGAGCACTGGATAGGAGGAAGG + Intronic
927994360 2:27472745-27472767 AAGAGCACTGCAAGGGTGGATGG + Intronic
930566042 2:53021953-53021975 GTAAAGACAGCATAGGTGGAGGG - Intergenic
932186737 2:69703391-69703413 GTGATCACTTAATGGGTGGAAGG - Intronic
932759007 2:74427454-74427476 GGAAGCACTGCAGAGCTGGATGG - Exonic
934675111 2:96244285-96244307 GTGTGCACTGCATAGGTGGTAGG + Intergenic
934936401 2:98469079-98469101 ATTAGCACAGCATGGGTGGAGGG - Intronic
935157607 2:100497156-100497178 GTGGGCACTGCATGGGTCCATGG - Intergenic
936884755 2:117297119-117297141 GTGAACACTGCTTAGGTGATTGG - Intergenic
937733458 2:125261505-125261527 GTAAGTACTGCCTAGGTGGTTGG - Intergenic
938387698 2:130879079-130879101 CTGAGCACAGCACAGGTGGGAGG + Intronic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
941461087 2:165772777-165772799 TTGAGTACAGCATAAGTGGAAGG + Intronic
941918664 2:170828571-170828593 GTGAGGACAGCAGAGGAGGACGG - Intronic
941923941 2:170877649-170877671 GTCAGCACTGCAAAGGTGAAAGG - Intergenic
943623685 2:190177374-190177396 GTGAGGACTGGAGAGGGGGATGG - Intronic
947516435 2:230808904-230808926 CTGGGCACTGCATAGGTGCTGGG + Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171374777 20:24685152-24685174 CTGAGCCCTGCAGAGGTGAAGGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176873452 21:14102706-14102728 GTGATCACTGCAACGGTTGAGGG + Intergenic
1177191388 21:17855794-17855816 GTGCTCACTGCATTGGTGCATGG + Intergenic
1178866374 21:36331120-36331142 GTGAGCACTACAGATGTGGTTGG + Intronic
1178972717 21:37195216-37195238 GTCAGCACTGCAGGCGTGGACGG + Intronic
1179561667 21:42219520-42219542 GAGAGCACGGACTAGGTGGAGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180613749 22:17114267-17114289 GAGAGCCATGCAGAGGTGGAGGG - Exonic
1182009456 22:26988295-26988317 GTGAGGACTGTCCAGGTGGATGG + Intergenic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1184850473 22:47116799-47116821 GTGTGCAGTGCCTAGGTTGAGGG + Intronic
952651248 3:35729352-35729374 GTGTGCTCTGGAGAGGTGGATGG - Exonic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG + Exonic
954785617 3:53090203-53090225 GTGGGCACGGGATAGGTGCAGGG + Exonic
954945816 3:54423529-54423551 GAGAGCAATGCTTATGTGGAGGG + Intronic
954966833 3:54619308-54619330 ATGTGCACTGCTTAGGTGGAGGG + Intronic
960268884 3:115652680-115652702 TTGAACACTGCATAGGCGGCTGG - Intronic
961520260 3:127463323-127463345 GTGAGGACGGCATTGGTGGTGGG - Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
963703034 3:148650475-148650497 ATGGGCACTGCTTAGGGGGAGGG - Intergenic
965435341 3:168643732-168643754 GTGAAACCTGCATATGTGGAGGG - Intergenic
969709933 4:8836939-8836961 GTGAGCACTGCAGGGTGGGAAGG + Intergenic
974065168 4:57070976-57070998 GTGTGCAATGAATAGGTGCAGGG - Intronic
975706993 4:77121477-77121499 GTCATCACTGCATGGGTGCATGG - Intergenic
975786940 4:77900794-77900816 GTGAGAACTGTATAAGTGGTAGG + Intronic
978549167 4:109906039-109906061 GTGTACACTGCTTAGGTGAAGGG + Intergenic
983829435 4:172306559-172306581 GTGTGCACTGCTTAGGTGATGGG - Intronic
985800780 5:2004364-2004386 GTGAGCACAGCATGGAGGGAAGG + Intergenic
985958869 5:3284450-3284472 GTGAGCCCTACATAGGGGAAAGG + Intergenic
993922273 5:93820228-93820250 TTGAGCACTGCAAACGGGGAAGG + Intronic
997736862 5:136219358-136219380 ATGAGCACTGCAGATGTGCAGGG + Intronic
998526309 5:142846339-142846361 GTCACCAGTGCATAGGTGGGAGG + Intronic
998791634 5:145771887-145771909 GTGGGAACTGCATGGGAGGAAGG + Intronic
999175721 5:149630476-149630498 GTGAGTGCTGCATAGGTGTCTGG + Intronic
999627158 5:153532878-153532900 GTCACCTCTGCATAGGTGTATGG + Intronic
1002640288 5:180627558-180627580 GCGAGCACTGACTGGGTGGACGG - Intronic
1006288181 6:33113910-33113932 GTGGGCAGTGAACAGGTGGACGG + Intergenic
1006428993 6:33983673-33983695 GTATTCACTGCATAGGTGGGTGG + Intergenic
1007415570 6:41689403-41689425 GAGAGCACTGCATGGGTGGAGGG - Intronic
1017295302 6:152786630-152786652 GTGAACACTGCTTGGGTGGTGGG - Intergenic
1020944177 7:14580191-14580213 GTGTGAACTTCATAGGCGGAGGG - Intronic
1022041271 7:26583804-26583826 GTGAGCACTGCAAAGCAGGACGG - Intergenic
1024177815 7:46859751-46859773 GTGTGCACTGCTTAGGTGATGGG - Intergenic
1028237397 7:88378899-88378921 GTGTGCACTGCTCAGGTGGTGGG - Intergenic
1029943000 7:104500008-104500030 ATGAGCACTGTATATGTGGATGG + Intronic
1030525225 7:110644800-110644822 TTCAGCACTGGATAGATGGATGG + Intergenic
1034356090 7:150451559-150451581 GTGAGCCCTGAAGAGGAGGAGGG + Intronic
1034897218 7:154885334-154885356 GTGTGGACTGCACAGGTGTAAGG - Intronic
1039573640 8:38606149-38606171 ATGAGCACTGCAGAAGTAGATGG + Intergenic
1039575797 8:38623098-38623120 GTGTGCACTGGATGGGTGGCTGG + Intergenic
1039890309 8:41681522-41681544 GTGAGCACGACATAAGTGGGTGG - Intronic
1044390235 8:91641452-91641474 GTCAGCACAGCATAAGTGGGTGG - Intergenic
1047560971 8:125987893-125987915 GTAAGCACTGCCTTGGTGGTTGG + Intergenic
1048404968 8:134109891-134109913 TTGAGCACTACCTAGGTGTAGGG + Intergenic
1048452712 8:134548175-134548197 TTAAGCACTGCATAGGTGCTGGG + Intronic
1052294884 9:26886368-26886390 GTGAACACTGCATATTTGAAGGG + Intronic
1053533487 9:38904393-38904415 GAAAGCACTGCATATGGGGAGGG - Intergenic
1054134677 9:61408689-61408711 GTGGGGAGTGCATGGGTGGATGG + Intergenic
1054205712 9:62128822-62128844 GAAAGCACTGCATATGGGGAGGG - Intergenic
1054632649 9:67459548-67459570 GAAAGCACTGCATATGGGGAGGG + Intergenic
1056927527 9:90847554-90847576 GTGAGCCCTGCAGGTGTGGAGGG - Intronic
1058755457 9:108079128-108079150 GTGAGAACTGCATTTGTGGAGGG + Intergenic
1060627421 9:125126331-125126353 GGCAGCACTGCATAGAGGGAAGG - Intronic
1061668032 9:132171803-132171825 GTCAGCTCTGCATTGTTGGATGG - Intronic
1061744800 9:132731616-132731638 GTGAGCACTGCATATGGACATGG + Intronic
1185570302 X:1129197-1129219 GTGTGCACTGCATGTGTGTATGG - Intergenic
1186510358 X:10125681-10125703 GTGAGCACTGCAGAGGTCATTGG - Intronic
1187900547 X:24024168-24024190 GTTAGCACTTCGTAGGAGGAAGG + Intronic
1188986785 X:36775225-36775247 AGCAGCACTGCATGGGTGGAGGG - Intergenic
1189358125 X:40327014-40327036 GTGGGCACTGAATGGGAGGAGGG + Intergenic
1191749899 X:64530619-64530641 GTGTACACTGCATGGGTGGTGGG + Intergenic
1196018998 X:110969705-110969727 GAGAGCATTGTATTGGTGGAAGG - Intronic
1200399164 X:156008682-156008704 GGGAGCACTGCAGTGATGGAGGG + Intronic
1201769060 Y:17600057-17600079 GTGATCACTGCAAGGGTTGAGGG + Intergenic
1201832494 Y:18305928-18305950 GTGATCACTGCAAGGGTTGAGGG - Intergenic