ID: 1094488515

View in Genome Browser
Species Human (GRCh38)
Location 12:30943838-30943860
Sequence GCACAGAAGGACAAGGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 399}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094488507_1094488515 29 Left 1094488507 12:30943786-30943808 CCACTCATCGGGAATGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1094488515 12:30943838-30943860 GCACAGAAGGACAAGGCTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094488515 Original CRISPR GCACAGAAGGACAAGGCTGT TGG Intronic
900378943 1:2374116-2374138 TCACAGAAGGACCAGCCAGTTGG - Intronic
902389275 1:16093358-16093380 GCCTAGGAGGTCAAGGCTGTAGG - Intergenic
902540872 1:17153668-17153690 GCTCAGGAGGTCAAGGCTGCAGG - Intergenic
904549438 1:31303203-31303225 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
904738724 1:32655064-32655086 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
904825786 1:33272928-33272950 GGACAGAGGGACAAGGCAGAAGG - Intronic
905194926 1:36268577-36268599 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
905261467 1:36722083-36722105 GCATTGAAGGACAGGGGTGTGGG + Intergenic
906284066 1:44574574-44574596 GCACTGAAGGGCCAGGCTTTAGG - Intronic
906587435 1:46991733-46991755 TGACAGGAGGACAAGCCTGTTGG + Intergenic
907134601 1:52127962-52127984 GCAGAGAAGGAGAAGGCTTGAGG - Intergenic
907229234 1:52980048-52980070 GCACAGGAGGTCAAGGCTGCAGG - Intronic
907596367 1:55723844-55723866 CCCCAGAAGGAGCAGGCTGTGGG - Intergenic
911264739 1:95729842-95729864 GCCCAGGAGGTCGAGGCTGTAGG + Intergenic
911381159 1:97116593-97116615 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
912191895 1:107350739-107350761 GCACAGAAAGACAATGCTGCAGG + Intronic
912340889 1:108913966-108913988 TAACAGAAGGAAAAGGCTGTAGG - Intronic
912365230 1:109127980-109128002 GCACAGGAGGCTAAGGCTGGAGG - Intronic
913972173 1:143423708-143423730 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
914066554 1:144249321-144249343 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
914112599 1:144717033-144717055 GCCCAGAAGGACCTGGGTGTGGG + Intergenic
914239431 1:145842887-145842909 GCTCAGGAGGTCAAGGCTGTAGG - Intergenic
915003371 1:152613901-152613923 GCACAGCAGGAGGAGGCTGGAGG - Exonic
915668879 1:157470455-157470477 CCACTGAAGGACAGGGCAGTGGG - Intergenic
916731264 1:167569011-167569033 GCCCAGAAGATCAAGGCTGCAGG + Intergenic
917770759 1:178275264-178275286 GCTCAGAAGATCAAAGCTGTAGG - Intronic
918172918 1:182015179-182015201 GCCCAGGAGGCCAAGGTTGTAGG + Intergenic
918221624 1:182440879-182440901 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
919161861 1:193840606-193840628 GCACAGAGTGCCAAAGCTGTGGG - Intergenic
920204113 1:204279106-204279128 GCACAGAAGGAGGAGGGGGTAGG + Intronic
921982866 1:221277077-221277099 GCCCAGAACCACAAGGATGTGGG - Intergenic
922295939 1:224249808-224249830 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
922531992 1:226351748-226351770 GCACACATGGTCAAGGCTCTTGG + Intergenic
922544812 1:226448247-226448269 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
922576383 1:226663586-226663608 GCCCAGAAAGTTAAGGCTGTAGG - Intronic
923464583 1:234236773-234236795 GGAATGAAGGACAAGGCTGGAGG + Intronic
924270577 1:242327996-242328018 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
924425192 1:243944149-243944171 GAACAGAAGGAAAAGGCAGCCGG + Intergenic
1063126794 10:3142849-3142871 CCACAGAGGGACAGGGCAGTGGG - Intronic
1063892590 10:10645575-10645597 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1065094384 10:22266214-22266236 GCACAGTAGAAGAAGGCTGGGGG - Intergenic
1065880516 10:30033815-30033837 TCACAGAGGCAGAAGGCTGTGGG + Intronic
1065961213 10:30735719-30735741 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1066714369 10:38270798-38270820 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1069637872 10:69936660-69936682 TCACAGAAGAACAAGGGTTTTGG - Intronic
1069722747 10:70560149-70560171 GCTAAGAAGGGCAGGGCTGTTGG + Intronic
1069788508 10:71004853-71004875 GCACACAAAGGCAGGGCTGTGGG - Intergenic
1070323458 10:75372307-75372329 GCCCAGAAGCACAAGTCTCTTGG + Intergenic
1071399050 10:85251551-85251573 TCACAGAAGGACAACAGTGTGGG - Intergenic
1073249235 10:102111628-102111650 GCACAGGAGGTCGAGGCTGCAGG + Intronic
1074109289 10:110411032-110411054 GAATGGAGGGACAAGGCTGTCGG + Intergenic
1074512145 10:114123921-114123943 GCACAGGAGGTCAAGGCTGCAGG - Exonic
1075696688 10:124441271-124441293 GCCCAGGAGGTCCAGGCTGTAGG - Intergenic
1076241477 10:128911604-128911626 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1076644342 10:131942111-131942133 GAAGAGATGGACAAGGCTGGAGG - Intronic
1077307690 11:1875325-1875347 GCCCAGAAGGACCTGGGTGTGGG + Intronic
1077358023 11:2127600-2127622 GCACAGAAGCTCCTGGCTGTGGG + Intergenic
1079072823 11:17362995-17363017 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1080661129 11:34296842-34296864 CCACAGTTGGAGAAGGCTGTAGG + Intronic
1081558209 11:44187112-44187134 GCCCAGGAGGTCAAGGCTGTAGG - Intronic
1081663493 11:44902852-44902874 GCACAGGAGAACACGACTGTGGG + Intronic
1083514934 11:63248061-63248083 GCACAAAAGGAAAAAGCTGTAGG + Intronic
1083686683 11:64380664-64380686 GCACCGCAGGACTAGGCTGGGGG + Intergenic
1083990828 11:66244740-66244762 GCATAGAAGCCCAAGGCAGTCGG - Exonic
1084913582 11:72410724-72410746 CCACAGAAGGACAAATCAGTCGG + Intronic
1090473084 11:126997157-126997179 GCACAGAAGGAAATAGTTGTGGG + Intronic
1091484905 12:876661-876683 GCACATACGTAAAAGGCTGTTGG + Intronic
1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG + Intronic
1092011177 12:5113983-5114005 GAAGAGGAGGACAAGTCTGTAGG + Intergenic
1092180940 12:6446376-6446398 GCCCAGGAGTTCAAGGCTGTGGG - Intronic
1093007291 12:14064343-14064365 GAACAGAGGGACAAGACGGTCGG + Intergenic
1093111276 12:15155376-15155398 GCTCAGAAGGACTATGCTGGAGG - Intronic
1093247622 12:16759741-16759763 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1093313149 12:17617049-17617071 GCAGAGATGCCCAAGGCTGTGGG - Intergenic
1093897352 12:24589291-24589313 GCCCGGAAGGTGAAGGCTGTAGG + Intergenic
1094435725 12:30418957-30418979 ACACAGAAGGACAAGGACCTGGG - Intergenic
1094481082 12:30881923-30881945 GCACACAAGGAGTGGGCTGTGGG + Intergenic
1094488515 12:30943838-30943860 GCACAGAAGGACAAGGCTGTTGG + Intronic
1096107952 12:49009199-49009221 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1100176239 12:92034142-92034164 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
1100281043 12:93118513-93118535 GCACAGAAGTGTAAGGCTGCAGG - Intergenic
1100457777 12:94768838-94768860 GCAGAGGAGGAGAAGGCTTTAGG - Intergenic
1100994391 12:100287368-100287390 GCCCAGGAGGTCAAGGCTGTAGG - Intronic
1101010922 12:100448115-100448137 GCCCTGAAGGTCAAGGCTGCAGG + Intergenic
1101149541 12:101871897-101871919 GCCCATGAGGTCAAGGCTGTAGG - Intergenic
1101866639 12:108525117-108525139 GGACAGAGGGAGAAGGCTGCAGG + Intronic
1102381428 12:112469996-112470018 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1103421989 12:120793416-120793438 GCCCAGGAGGTCAAGGCTGATGG + Intronic
1103954578 12:124568952-124568974 GCAGAGAAGGACCTGGCTGCAGG - Intergenic
1104916058 12:132265221-132265243 GCGCAGGAGGACAAGGCTGGGGG - Intronic
1106898755 13:34333201-34333223 GCAGAGATGCCCAAGGCTGTGGG - Intergenic
1107344218 13:39441587-39441609 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1107499930 13:40963444-40963466 CCTCAGAAGGAGAAGGCTGTAGG - Intronic
1107676373 13:42802073-42802095 ACACAGAAGGACTAGGTTTTGGG - Intergenic
1108107592 13:47028329-47028351 GTAACGAATGACAAGGCTGTGGG - Intergenic
1111128998 13:83949980-83950002 AGACAGAAGGAGAAGGTTGTAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112781154 13:102902803-102902825 GCAGAGAAGGCCAAGGGGGTGGG + Intergenic
1112943039 13:104889953-104889975 CCAGAGAAGGACATAGCTGTAGG + Intergenic
1113468985 13:110531142-110531164 GCACAGATGGAGAAGGAGGTGGG + Intronic
1113867204 13:113534711-113534733 GCCCAGGAGGCCAAGGCTGCAGG + Intronic
1114476540 14:22999010-22999032 GCACTGAAGGACATGGCGGATGG + Exonic
1115022914 14:28704685-28704707 GCAAGGAAAGACAAAGCTGTGGG + Intergenic
1115608994 14:35034159-35034181 GCACAGCTGCCCAAGGCTGTGGG - Intergenic
1116628678 14:47300564-47300586 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1117396211 14:55312779-55312801 GCACAAAGCAACAAGGCTGTGGG + Intronic
1118235717 14:64003613-64003635 ACACAGAAGGACAAGGGAATCGG - Intronic
1118344593 14:64928322-64928344 GCACGGGAGGTCAAGGCTGCAGG - Intronic
1118406543 14:65429784-65429806 GCACGGGAGGTCAAGGCTGCCGG + Intronic
1120558113 14:85955551-85955573 GCACACTAGGAAAAAGCTGTGGG + Intergenic
1120779293 14:88471827-88471849 CAACACAAGGTCAAGGCTGTAGG + Intronic
1121937881 14:98037218-98037240 ACAGAGAAAGACAAGCCTGTGGG + Intergenic
1122100742 14:99407744-99407766 GCGCATAAGGACTGGGCTGTGGG - Intronic
1122111173 14:99503777-99503799 GAACAGAAAGACAATGCTGATGG - Exonic
1122262442 14:100531103-100531125 TCAGAGAAGGTCAAGTCTGTGGG + Intergenic
1122771960 14:104101563-104101585 GCACAGAAGGGTAAGGGTGCAGG - Intronic
1124899636 15:33810267-33810289 GCGCAGAAGGAGAAGGCTCAGGG + Intronic
1125820714 15:42627674-42627696 GCACAGAAAGACAAACTTGTGGG - Intronic
1129611686 15:77065067-77065089 GAACTGAAGGAACAGGCTGTAGG - Intronic
1130406902 15:83610454-83610476 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1130807414 15:87340456-87340478 GCAGAGAAGAAAATGGCTGTGGG + Intergenic
1132742134 16:1420123-1420145 GCACTGAAGGACTTGGCTGGTGG - Exonic
1133103690 16:3493928-3493950 GCCTAGAAGGACTAGGCTGGGGG + Exonic
1133605184 16:7379929-7379951 ACCCAGGAGGCCAAGGCTGTGGG - Intronic
1133876395 16:9738932-9738954 GCAGAGCAGGACCAGGCAGTTGG + Intergenic
1134078732 16:11310211-11310233 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1134296796 16:12953394-12953416 GCACAGAAAGATGAAGCTGTTGG + Intronic
1136103415 16:28011651-28011673 GCACAGAAGGAGGAGGCAGATGG - Intronic
1136183282 16:28569813-28569835 GCCCAGAAGGCCCAGGGTGTTGG + Intronic
1137043051 16:35631270-35631292 GCCCAGAAAGTCAAGGCTGTGGG - Intergenic
1137908098 16:52346427-52346449 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1137908489 16:52351127-52351149 ACACAGCAGTACAATGCTGTGGG + Intergenic
1138025114 16:53516116-53516138 GCACAGAAGGCCACAGCTGGTGG - Intergenic
1138359674 16:56417331-56417353 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1138660125 16:58511833-58511855 GCACAGAAGGGCAGGGCCATAGG + Exonic
1138697033 16:58823974-58823996 GCAAAGAAGAACAAAGCTGGAGG - Intergenic
1139396521 16:66644052-66644074 GCACAGAAGTACTTGGCTGTTGG - Intronic
1139680725 16:68559943-68559965 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1140223732 16:73063070-73063092 CCACAAAAGGACGAGGCTGCCGG - Intergenic
1140401730 16:74677426-74677448 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1142395710 16:89830002-89830024 GCAGAGCAGGAGGAGGCTGTAGG + Intronic
1142527155 17:551488-551510 GCCCAGAGGGTCAAGGCTGCAGG + Intronic
1143537150 17:7548440-7548462 TCCCAGAAGGCCAAGGCTGGGGG - Intergenic
1143704838 17:8689889-8689911 GCCCAGAAGTTCAAGGCTATAGG + Intergenic
1144081825 17:11770051-11770073 ACAGAGTGGGACAAGGCTGTCGG - Intronic
1144822915 17:18088072-18088094 ACACAGAAGAACAAGGGTGAGGG + Exonic
1146583154 17:34057977-34057999 GCACACAAGTACATGGGTGTAGG - Intronic
1146605469 17:34253983-34254005 GCTCAGAAGGAGGAGGCAGTGGG + Intergenic
1147397022 17:40151615-40151637 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1148109516 17:45136768-45136790 GCACAGAAGGTAAGGGCTGCAGG + Exonic
1148548567 17:48535188-48535210 GCCCAGGAGGTCAAAGCTGTAGG - Intergenic
1148557217 17:48585746-48585768 GCACCTAAGGACAAGCCTGCAGG + Intronic
1148954230 17:51340370-51340392 GCCAAGAAGGCCAAGGCTGGAGG - Intergenic
1149451393 17:56752552-56752574 GAACAGAAGAACAGAGCTGTAGG - Intergenic
1149591247 17:57831395-57831417 GGAAAGAAGAACATGGCTGTGGG - Intergenic
1149775160 17:59351472-59351494 CCACAGAAGACCAATGCTGTTGG - Intronic
1149845371 17:60006439-60006461 GCACAGGAGCACCAGGCTGGGGG - Intergenic
1150459538 17:65337034-65337056 GCCCAGAGGGTCAAGGCTGCAGG - Intergenic
1151968777 17:77446319-77446341 GCAGAGAAGGAGGAGGCTGTAGG - Intronic
1151974854 17:77478926-77478948 TCACAAAAGGACAATCCTGTAGG + Intronic
1152702594 17:81826444-81826466 GCCCAGGAGGTCAAGGCTGCAGG + Exonic
1153949766 18:10048188-10048210 GAACACAAGGACAGGGCTGGGGG - Intergenic
1154168911 18:12036652-12036674 GCACGGAGGGCCAAGTCTGTTGG + Intergenic
1155128631 18:22906214-22906236 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1157761219 18:50267013-50267035 GCCCAGGAGGACGAGGCTGCAGG - Intronic
1157968323 18:52235647-52235669 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1158102775 18:53849103-53849125 GCACACAAGTACAGGGCAGTAGG - Intergenic
1159522009 18:69538457-69538479 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1159534840 18:69703107-69703129 ACACAGAAGGAAAAGGCACTAGG + Intronic
1159664409 18:71140578-71140600 GAACACAAGGACCATGCTGTAGG + Intergenic
1160935451 19:1592550-1592572 GCCCAGAAGGTCGGGGCTGTCGG - Exonic
1161059080 19:2205768-2205790 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1161201475 19:3017525-3017547 GCCCAGAAGGCCAAGGCTGAAGG - Intronic
1161346023 19:3769176-3769198 GCCCAGAAGGTCGAGGCTGCAGG - Exonic
1161511312 19:4673653-4673675 GCCCAGGAGGTTAAGGCTGTAGG - Intergenic
1161949170 19:7458208-7458230 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1162405565 19:10471126-10471148 ACCCAGAAGTTCAAGGCTGTAGG - Intergenic
1162676405 19:12301781-12301803 ACCCAGAAGGTCAAGGCTGCAGG + Intergenic
1162697244 19:12485747-12485769 GCCCAGAAGGTCGAGGCTGCAGG - Intronic
1162774506 19:12971020-12971042 GCAGAGAAGGACCAGGATTTGGG + Intronic
1162797935 19:13096127-13096149 GCACAGAAAGACAAGCCAGAGGG - Exonic
1162830863 19:13283381-13283403 GCACAGGCGGCGAAGGCTGTTGG + Exonic
1162929495 19:13950242-13950264 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1163593293 19:18206031-18206053 GCTCAGGAGGTCGAGGCTGTAGG + Intergenic
1163885276 19:19959836-19959858 GGCCAGAAGGACAGGGCTGGAGG + Intergenic
1163934772 19:20432953-20432975 GGCCAGAAGGACAGGGCTGATGG + Intergenic
1163938385 19:20471219-20471241 GGCCAGAAGGACAGGGCTGGAGG - Intergenic
1165352622 19:35284366-35284388 GCACAGGAGGTCAAGGCTGCAGG + Intronic
1165940047 19:39410373-39410395 GAACAGAAGGCAAAGGGTGTAGG - Intergenic
1166184954 19:41133795-41133817 GCACAGAAGTGCCAGGCTGATGG + Intergenic
1166229613 19:41418606-41418628 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
1166683710 19:44782506-44782528 GCTCAGCAGAACAAGGCTGCAGG + Intronic
1166858481 19:45795495-45795517 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1167644141 19:50696574-50696596 CTCCAGAAGGACAGGGCTGTGGG - Intronic
1167693329 19:51000550-51000572 GCACAGGAGGACAAGGTGCTGGG - Exonic
1168191093 19:54739351-54739373 GCACCCAAGAACAGGGCTGTCGG - Intronic
1168193354 19:54755958-54755980 GCACCCAAGAACAGGGCTGTCGG - Intronic
1168195414 19:54770693-54770715 GCACCCAAGAACAGGGCTGTCGG - Intronic
926054600 2:9767176-9767198 GCCCAGAAGGTCGAGGCTGCAGG - Intergenic
926190387 2:10723210-10723232 GAACAGGGGGACAAGGTTGTGGG + Intronic
927267854 2:21173016-21173038 GCACAGAATGCAAAAGCTGTAGG - Intergenic
927410598 2:22820958-22820980 GCACCGAAGGAAGAGGTTGTGGG + Intergenic
927549132 2:23981809-23981831 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
927674326 2:25093415-25093437 GCCCAGAAGGTCGAGGCTGCAGG + Intronic
927689498 2:25197779-25197801 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
927920337 2:26967382-26967404 GCCCAGCATGTCAAGGCTGTAGG + Intergenic
928439385 2:31279237-31279259 GCACAGCCGGGCAAGGCTGGAGG - Intergenic
928989129 2:37212960-37212982 GCCCAGAAGGTCTAGGCTGCAGG + Intronic
929664850 2:43826050-43826072 GCCCAGTAGGTCAAGGCTGCAGG - Intronic
933730021 2:85449368-85449390 GCTCAGAAGACCAAGGCCGTGGG + Intergenic
934176870 2:89584645-89584667 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
934287177 2:91659005-91659027 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
934927721 2:98393170-98393192 GCCCAGGAGGTCAAGACTGTAGG + Intronic
935465880 2:103397512-103397534 GCACAGAACAATAGGGCTGTAGG + Intergenic
936474328 2:112826549-112826571 GCAAAGGATGACATGGCTGTCGG - Intergenic
936486079 2:112926911-112926933 GCACAGAAGGGCTACCCTGTAGG + Intergenic
936921577 2:117694617-117694639 CCACAGATGGATAAGGCTGAGGG - Intergenic
937773775 2:125751982-125752004 GCACAGAAGGAGAAGCTTTTTGG - Intergenic
939139189 2:138333286-138333308 GAAAAGAGGGACAAGGCTTTTGG - Intergenic
939385355 2:141489050-141489072 GCCCAGAAGGTGAAGGCTGCAGG - Intronic
942704763 2:178758032-178758054 ACATACAAGGACAAGGCAGTAGG - Intronic
944122059 2:196251114-196251136 GCTCAGAAGGTCAAGCCTGCAGG - Intronic
944827668 2:203501903-203501925 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
946268295 2:218568115-218568137 GCACAGAAGGAGGAGGAGGTAGG + Intronic
946820735 2:223626878-223626900 GCACACAGGGAGAATGCTGTGGG + Intergenic
948027418 2:234789262-234789284 GCACAGAAGGACAGGGGTCTTGG - Intergenic
948305016 2:236940260-236940282 CCACAGAAGGACCAGGGTGGGGG + Intergenic
949027440 2:241773222-241773244 GCTCAGGAGGTCGAGGCTGTGGG + Intergenic
949078909 2:242080691-242080713 GGACATAGGGAGAAGGCTGTAGG + Intergenic
1168827535 20:823610-823632 GGACAGATGGAGAAGGCTGGGGG - Intergenic
1169108058 20:3014278-3014300 ACACAGAAGGAGAAAGCTTTAGG - Intronic
1169357677 20:4921507-4921529 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1169370581 20:5026128-5026150 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1169650513 20:7861483-7861505 GCCCAGTAGTTCAAGGCTGTAGG + Intergenic
1170205149 20:13790061-13790083 GCACAGAGGTAGAATGCTGTAGG + Intronic
1170557003 20:17522841-17522863 GCTCAGAGGGACAAGGCAATTGG + Intronic
1171471981 20:25379477-25379499 GGAAGGAAGGCCAAGGCTGTGGG - Intronic
1171722424 20:28577650-28577672 GCCCAGAAGTTCAAGGCTGCAGG - Intergenic
1171755655 20:29105802-29105824 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
1171787020 20:29477088-29477110 GCCCAGAAGCTCAAGGCTGCAGG - Intergenic
1171999798 20:31765029-31765051 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1172074404 20:32283111-32283133 GCCCAGGAGTTCAAGGCTGTGGG - Intronic
1172440487 20:34962148-34962170 GCCCAGTAGGTCAAGGCTGCAGG + Intergenic
1172737615 20:37139708-37139730 GCCCAGTAAGACAAGGCTGCAGG - Intronic
1173658322 20:44716201-44716223 GCCCAGAATGACATGGATGTAGG + Intronic
1174265832 20:49331429-49331451 GCTCAGAAGATCAAGGCTGCAGG - Intergenic
1175686852 20:61036855-61036877 AGAGAGAAGGACAATGCTGTAGG - Intergenic
1175941948 20:62541492-62541514 GCACAGAAGGAGGTGGCTGGGGG - Intergenic
1175978064 20:62723508-62723530 GCACAGTAGGAAGCGGCTGTCGG + Intronic
1176101105 20:63364988-63365010 GCACCCAAGGAGATGGCTGTGGG + Intronic
1176209522 20:63911748-63911770 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1176662833 21:9655813-9655835 GCAGTGAAGGAGAAGACTGTTGG - Intergenic
1178248404 21:30976327-30976349 ACACATAATGGCAAGGCTGTTGG - Intergenic
1178324968 21:31637858-31637880 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1179361539 21:40714059-40714081 GCACAGAATGCAAAAGCTGTGGG + Intronic
1179426487 21:41283531-41283553 GCACAGAATGAAAAAGCTCTGGG - Intergenic
1180412696 22:12629670-12629692 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
1180632034 22:17236329-17236351 GCCCAGGAGTTCAAGGCTGTGGG + Intergenic
1181452749 22:23034829-23034851 GCTCATGAGGAGAAGGCTGTAGG - Intergenic
1182190999 22:28460758-28460780 GCCCAGGAAGTCAAGGCTGTAGG - Intronic
1183287637 22:36977430-36977452 CCCCAGCAGGCCAAGGCTGTGGG + Intergenic
1184014829 22:41778063-41778085 GCCTAGGAGGTCAAGGCTGTGGG - Intronic
1184073540 22:42161872-42161894 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1184678835 22:46058872-46058894 GCACAGCAGGACAAGGAGGCTGG - Intronic
1184735259 22:46394247-46394269 GCACGGAAGGTCGAGTCTGTGGG + Exonic
1185026208 22:48414721-48414743 GAAGTGAAGGAAAAGGCTGTGGG - Intergenic
1185041258 22:48505592-48505614 CCACAGGTGGACAAAGCTGTAGG - Intronic
950379873 3:12603148-12603170 GCCCAGAAGTTCTAGGCTGTAGG - Intronic
950589493 3:13926191-13926213 GCCCAGAAGGAGAAGGTTGCAGG + Intergenic
950647340 3:14385055-14385077 CCACAAAGGGACAATGCTGTGGG - Intergenic
950662055 3:14472714-14472736 GCACAGGAGGACATGGCAGATGG + Intronic
951924200 3:27888968-27888990 GCACTGAATAACAAGGCTATAGG - Intergenic
952071502 3:29642606-29642628 GGACAGCAGAACAAGACTGTGGG + Intronic
952649438 3:35707444-35707466 CAACTGAAGGACAAAGCTGTAGG - Intronic
953005169 3:38971229-38971251 GCCCAGGAGGTCAAGGCTGCGGG - Intergenic
953165089 3:40457644-40457666 ACACGGCAGGACAAGGCTCTCGG - Intronic
954430794 3:50470013-50470035 GCACAGAGGGGCAGGTCTGTGGG - Intronic
954674774 3:52309739-52309761 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
955403528 3:58610463-58610485 GGATAGAAAGAGAAGGCTGTGGG + Intronic
957235584 3:77584735-77584757 TCTCAGAAGGACAAGATTGTAGG - Intronic
957248909 3:77747854-77747876 GCCCAGAAGTTCAAGGCTGTAGG + Intergenic
958069941 3:88597246-88597268 GCTCAGAAGGAGAGAGCTGTAGG + Intergenic
961997309 3:131259570-131259592 GGACAGAAGGAGAAGGATGCAGG + Intronic
963288466 3:143462294-143462316 GCCCAGCAGATCAAGGCTGTGGG + Intronic
966179696 3:177176901-177176923 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
966921634 3:184615584-184615606 GCAGAGTAGGACAGGGCTGGAGG - Intronic
966932436 3:184684636-184684658 GCACGGAAAGACAAGGATGATGG + Intronic
968334335 3:197900548-197900570 CCACAGCAGAACAAGGCTCTGGG + Intronic
968334354 3:197900671-197900693 CCACAGCAGAACAAGGCTCTGGG + Intronic
968574631 4:1359896-1359918 GCACAGCAGGAAAAGGAGGTGGG - Intronic
969048584 4:4356501-4356523 GCACACAGGGCCACGGCTGTTGG + Intronic
969051532 4:4376725-4376747 ACACACAGGGAAAAGGCTGTGGG - Intronic
969059856 4:4425977-4425999 ACACACGAGGACAGGGCTGTGGG - Intronic
969448279 4:7257750-7257772 GCAGAGAAGGACAAGGGGCTGGG - Intronic
969600314 4:8172199-8172221 GCACAGAAGGAAAGGGAAGTGGG + Intergenic
970442419 4:16093266-16093288 CCACAGTAGGACAGGGCAGTGGG + Intergenic
972726502 4:41750372-41750394 GCAAAGAAGCACAAGGCTGGGGG - Intergenic
975791731 4:77960550-77960572 GCCCAGGAGGCCAAGGCTGCAGG - Intergenic
977010908 4:91631724-91631746 GCTCAGGAGTTCAAGGCTGTAGG + Intergenic
977764069 4:100776931-100776953 GCACAGAAGGAGAATCCAGTGGG + Intronic
978593512 4:110351969-110351991 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
978786007 4:112610060-112610082 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
978862358 4:113465739-113465761 GCCCAGGAGGTCAAGGCTGTAGG - Intronic
980491706 4:133535771-133535793 GCCCAGAAGGTCGAGGCTGCAGG + Intergenic
981452993 4:144920811-144920833 GCACAGAAGGACATGCATGGTGG + Intergenic
981486056 4:145287475-145287497 GCAGATAAGGACAATGCTCTAGG - Intergenic
981715655 4:147749218-147749240 GGATACAAGGACAAGGTTGTTGG + Intronic
983536437 4:168862241-168862263 GCCCAGGAGAACAAGGCTGCAGG - Intronic
983644129 4:169972569-169972591 GCCCAGGAGGTCGAGGCTGTAGG - Intergenic
985220373 4:187697333-187697355 GCAGAGATGTTCAAGGCTGTGGG + Intergenic
985412490 4:189700236-189700258 GCAGTGAAGGAGAAGACTGTTGG + Intergenic
985439811 4:189972760-189972782 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
986027666 5:3865800-3865822 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
986285601 5:6356125-6356147 TCAGAGAAACACAAGGCTGTTGG - Intergenic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
989563213 5:42874736-42874758 ATAAAGAAGCACAAGGCTGTTGG - Intronic
989729244 5:44628412-44628434 ACACAGAAAGAGAAGGCTGAAGG - Intergenic
990269502 5:54120527-54120549 GCATAGAAAGAAAAAGCTGTGGG + Intronic
990477823 5:56178264-56178286 GCCTAGAAGGTCAAGGCTGCAGG - Intronic
990488314 5:56280298-56280320 GCACAGAAGGAGAAGGGAGGAGG + Intergenic
990770202 5:59235305-59235327 GCACAGGAGGAAAAGGCCTTTGG - Intronic
991028023 5:62051999-62052021 GCACAGGAGGAGGGGGCTGTGGG + Intergenic
992470906 5:77052274-77052296 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
997540719 5:134659729-134659751 GCACAGGAGGTTAAGGCTGCAGG - Intronic
997548895 5:134735194-134735216 GCCCAGGAGTTCAAGGCTGTAGG + Intergenic
998613077 5:143710586-143710608 GCACAGAAGGACCAGGCCAGAGG + Intergenic
998825100 5:146093432-146093454 GCTCAGAAAGTCGAGGCTGTCGG + Intronic
999285808 5:150393586-150393608 ACACAGAGGGACAGGGCAGTGGG + Intronic
999327671 5:150653183-150653205 GCACAGTACGAAAAGGCTGCAGG - Exonic
999756330 5:154667392-154667414 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1001513253 5:172338128-172338150 GGACAGAAAGCAAAGGCTGTGGG + Exonic
1002360150 5:178664110-178664132 GCCCAGGAGGTCAAGGCTGTAGG - Intergenic
1004703704 6:18103045-18103067 GCACAGAAGGAGAAGGCAGAAGG + Intergenic
1005360546 6:25027488-25027510 GCACAGAAGGAAAAGCGTTTGGG + Intronic
1006256420 6:32836129-32836151 GCACAGAGGGACAAGCCTGAGGG - Intronic
1006969240 6:38023940-38023962 GCCCAGGAGGTCAAAGCTGTAGG + Intronic
1007907815 6:45480896-45480918 GCACAGCAAGACCAGGCTGTGGG + Intronic
1008201939 6:48601447-48601469 GCACAAAATGATAAGTCTGTTGG - Intergenic
1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG + Intronic
1010978908 6:82348109-82348131 GCACAGCAGGTCAAGAATGTTGG - Intergenic
1011602687 6:89074737-89074759 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1014983062 6:127967698-127967720 GCCCAGAGGGACATGGCTGGGGG + Intergenic
1015178677 6:130338593-130338615 GCACAGCTGCCCAAGGCTGTGGG + Intronic
1015751181 6:136560868-136560890 GCCCAGCAGGTCAAGGCTGCAGG + Intronic
1015927924 6:138328918-138328940 GCCCAGGAGGCCAAGGCTGTAGG + Intronic
1016035575 6:139379411-139379433 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1016833609 6:148455904-148455926 GCACTGAAGGCCAAGGCTGGAGG - Intronic
1017437873 6:154435070-154435092 GCCCAGGAGGTCAAGGCTGCCGG - Intronic
1017832071 6:158139646-158139668 GCCCAGGAGTTCAAGGCTGTAGG + Intronic
1017840044 6:158214438-158214460 GCCCAGCAGTTCAAGGCTGTAGG + Intergenic
1017879338 6:158548889-158548911 GCAGAGAAGGTGAAGGGTGTTGG + Intronic
1018441893 6:163821303-163821325 GCTCAGAAGGGAAAGCCTGTGGG + Intergenic
1019225623 6:170505225-170505247 ACACAAAAGGACAAGGCGATGGG + Intergenic
1019513818 7:1431064-1431086 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1020084314 7:5302464-5302486 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1020769365 7:12368923-12368945 ACTAAGAAGGAAAAGGCTGTAGG + Intronic
1021364716 7:19762934-19762956 GCACAGAAGGTCATGGCATTAGG + Intronic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023326267 7:39060860-39060882 ACACAGGAGTTCAAGGCTGTAGG + Intronic
1024053528 7:45645369-45645391 GCAGAAAAGGACATTGCTGTGGG - Intronic
1024279577 7:47708578-47708600 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1024902247 7:54333338-54333360 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1025209974 7:57014734-57014756 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1025244524 7:57306435-57306457 GCCCAGAAGGTCAAGGCTGCAGG + Intergenic
1025661977 7:63562117-63562139 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1026104170 7:67407903-67407925 ACACAGAAGGAGAAGGAAGTGGG - Intergenic
1026510288 7:71021716-71021738 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1027752800 7:82172527-82172549 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1027934928 7:84589772-84589794 GTACAGAAGGAAAAGCCAGTGGG - Intergenic
1028130319 7:87163964-87163986 GCTCAGAAGTTCAAGGCTCTAGG + Intronic
1028704471 7:93822693-93822715 TCACAGAAGGAAAAGAGTGTGGG - Intronic
1029305908 7:99619976-99619998 GCACTGGAGGCCAAGGCGGTGGG + Exonic
1031134389 7:117870566-117870588 GCTCAGAATGACAAGAATGTTGG + Intronic
1032075079 7:128832292-128832314 TTCCAGAAGGACAAGGCTGAGGG + Intronic
1032442166 7:131950207-131950229 CCACAGCAGGAAGAGGCTGTGGG + Intergenic
1032453738 7:132056223-132056245 GCAAAGAAGGACATTGCTGCAGG + Intergenic
1034263072 7:149769101-149769123 GCACAGAAGGCTCAGCCTGTGGG - Exonic
1034648698 7:152671962-152671984 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1035157554 7:156926310-156926332 GGTCAGAGGGACAAGGCGGTTGG - Intergenic
1035394580 7:158526736-158526758 GCACAGATGGACAACCCTGTGGG + Intronic
1035537172 8:400710-400732 GGACATAGGGAGAAGGCTGTAGG + Intergenic
1036087157 8:5624770-5624792 GCCCAGCAGGTCAAGGCTGGAGG + Intergenic
1037564484 8:20105941-20105963 GCACAGAGGGAGAAGGGGGTGGG + Intergenic
1038007409 8:23444425-23444447 CCACAGAAGGGCAAGGGTGAGGG - Intronic
1038592451 8:28852140-28852162 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1038692790 8:29778409-29778431 ACACAGAAGGACAGAGCTTTGGG + Intergenic
1039118563 8:34119961-34119983 GAAGAGAAGGAGAAGGGTGTGGG - Intergenic
1039589773 8:38736537-38736559 GCTCAGGAGGTCAAGGCTGCAGG + Intronic
1039652199 8:39353884-39353906 GCACAGTTGCCCAAGGCTGTGGG + Intergenic
1041397008 8:57401790-57401812 ACACAGAAGGGCAAGGAGGTGGG + Intergenic
1041487151 8:58392030-58392052 GAAGAAGAGGACAAGGCTGTTGG - Intergenic
1041677610 8:60551132-60551154 GCAGAGCAGGGCAAGGATGTAGG - Intronic
1043280486 8:78459664-78459686 GAACAGAAGGAGAAGGATATGGG + Intergenic
1043423736 8:80127030-80127052 GCTCAGGAGGCCAAGGCTGCAGG + Intronic
1044091290 8:88005216-88005238 GCTCAGCTGGACAAGGCTATTGG - Intergenic
1045311607 8:101008052-101008074 GCACAGAAGAAGAAGGAGGTAGG + Intergenic
1046152123 8:110241021-110241043 ACACAGGAAGACAACGCTGTTGG - Intergenic
1046286597 8:112101168-112101190 GGATAGAAGGACAGGGCTATAGG - Intergenic
1047303893 8:123637758-123637780 GCACAGAAAGAGAAGGCCGTGGG + Intergenic
1048322877 8:133414995-133415017 GCACAGAAAGTCAAAGCTGTTGG - Intergenic
1049615467 8:143573966-143573988 GCACAGACAGGCAAGGGTGTGGG - Intergenic
1050543172 9:6687559-6687581 GCCCAGGAGGTCAAGGCTGCGGG - Intergenic
1052715735 9:32114857-32114879 GCACAGACGGACAAGGTGGAGGG + Intergenic
1052960820 9:34295282-34295304 GCCCAGGAGGTCAAGGCTGTAGG - Intronic
1053164692 9:35836134-35836156 TCACATAAGGACAAGGGTGCTGG + Intronic
1055416823 9:76092472-76092494 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1055573949 9:77644374-77644396 GCCCAGGAGGTCAAGGCCGTAGG + Intronic
1055673979 9:78636309-78636331 GCACAGAAGGAAACTGATGTGGG - Intergenic
1056843473 9:90017786-90017808 GGACAGAAGGACAAGCCAGGTGG + Intergenic
1057376057 9:94524133-94524155 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1058140827 9:101355385-101355407 GCACAGACTGCCAAGGCTGGGGG - Intergenic
1058575136 9:106392959-106392981 ACCCAGCAGGTCAAGGCTGTAGG - Intergenic
1058878850 9:109269037-109269059 ACTCAGAAGGAAAAGGCAGTTGG - Intronic
1058904471 9:109470617-109470639 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1059456004 9:114400631-114400653 GCAGAGAAAGGCAAGGCAGTGGG - Intergenic
1059824355 9:118010578-118010600 GCACAAAAGCATAAGGCTTTCGG + Intergenic
1061112795 9:128587160-128587182 GCACAGGAGGTCAAAGCTGTAGG - Intronic
1061199720 9:129130468-129130490 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1061241143 9:129373379-129373401 GCCCAGAAGGTCGAGGCTGTAGG - Intergenic
1061609714 9:131738727-131738749 GCACAGAAGGACATTTTTGTAGG - Intronic
1061629344 9:131862059-131862081 ACACAGAAGGACCACTCTGTGGG + Intronic
1202802832 9_KI270720v1_random:17354-17376 GCCCAGAAGCTCAAGGCTGCAGG - Intergenic
1203670103 Un_KI270755v1:2746-2768 GCAGTGAAGGAGAAGACTGTTGG - Intergenic
1186468451 X:9803003-9803025 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1187526777 X:20061491-20061513 GCACAGCAGGGCAGGGCTGAGGG - Intronic
1189186508 X:39059851-39059873 GCTCAGGAGAACAAGGCTGCAGG + Intergenic
1192412763 X:70949010-70949032 ACTCAGAAGGATAAGGCTGAAGG + Intergenic
1194653626 X:96545473-96545495 GCTCAGAAGGTCAAGGCTACAGG - Intergenic
1195040984 X:101014008-101014030 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1195151237 X:102072221-102072243 GAACAGTAGGGAAAGGCTGTGGG - Intergenic
1195549616 X:106152717-106152739 GCAAAAAAGAACAAAGCTGTAGG + Intergenic
1196729471 X:118926544-118926566 GCCCAGAAGGTCAAGGCTACAGG - Intergenic
1197093972 X:122572078-122572100 GCACAGTGGGAAAAGGTTGTGGG - Intergenic
1198532937 X:137563437-137563459 GCGCAAAAGGACGAGGCTGGGGG - Intergenic
1199450352 X:147972123-147972145 GCCCAAAAGGACAAAGCTGGAGG + Intergenic
1200387630 X:155908894-155908916 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1201601181 Y:15730221-15730243 GAACAAAAGGAGAAGGCTGTAGG - Intergenic