ID: 1094493660

View in Genome Browser
Species Human (GRCh38)
Location 12:30976566-30976588
Sequence TCAGTACCACACGCAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094493654_1094493660 7 Left 1094493654 12:30976536-30976558 CCTCCTGCCTCAGCTTACCCTGC 0: 1
1: 1
2: 27
3: 246
4: 2990
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1094493653_1094493660 26 Left 1094493653 12:30976517-30976539 CCACAGACGCTCTCTTCAGCCTC 0: 1
1: 0
2: 2
3: 25
4: 313
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1094493656_1094493660 0 Left 1094493656 12:30976543-30976565 CCTCAGCTTACCCTGCATACCAC 0: 1
1: 0
2: 1
3: 20
4: 149
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1094493655_1094493660 4 Left 1094493655 12:30976539-30976561 CCTGCCTCAGCTTACCCTGCATA 0: 1
1: 0
2: 2
3: 31
4: 516
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1094493657_1094493660 -10 Left 1094493657 12:30976553-30976575 CCCTGCATACCACTCAGTACCAC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1094493652_1094493660 30 Left 1094493652 12:30976513-30976535 CCATCCACAGACGCTCTCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 241
Right 1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094493660 Original CRISPR TCAGTACCACACGCAGACCC AGG Intronic
900341050 1:2189470-2189492 TCAGAACCAGACACAGCCCCAGG - Intronic
900469958 1:2848894-2848916 TCAGTTCCACACTCCCACCCAGG - Intergenic
902761523 1:18583858-18583880 CCAGAACCACACCCACACCCTGG - Intergenic
903537119 1:24074366-24074388 CCTGTACCCCAAGCAGACCCTGG + Intronic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
906812930 1:48847813-48847835 TCAGTACCAAACACAGAACCTGG + Intronic
912811799 1:112800682-112800704 TAACCACCACACGCAGTCCCAGG - Intergenic
914286978 1:146236222-146236244 TCAGTCCCTGACTCAGACCCTGG + Intergenic
915832855 1:159147112-159147134 CCAGTGGCACACGCAGTCCCAGG - Intergenic
921265277 1:213416639-213416661 CCACTGCCACACCCAGACCCTGG + Intergenic
922681100 1:227596521-227596543 TAACTACCACACCCAGAGCCTGG + Intronic
922710713 1:227828826-227828848 TCAGGCACACACGGAGACCCAGG - Intronic
1062840539 10:666826-666848 GAAATACCACAGGCAGACCCCGG + Intronic
1062895002 10:1096684-1096706 TCAGTACCGCGCGCAGAGCGGGG + Intronic
1067278329 10:44853437-44853459 TCAGCACCTCACCCAGAGCCAGG + Intergenic
1076105968 10:127823985-127824007 TCTGTACCAAACACAAACCCAGG - Intergenic
1077119814 11:901722-901744 CCTGGACCACACGCAGACCTGGG + Intronic
1077340702 11:2025108-2025130 TCAGGACCACAGGCAGCTCCTGG - Intergenic
1078070544 11:8106441-8106463 TCAGAACCACACCCAGAGGCTGG + Intronic
1082106701 11:48228928-48228950 TGAGCACCACGCGCAGTCCCCGG - Intergenic
1082125844 11:48430222-48430244 TCAGTCACACACAGAGACCCAGG - Intergenic
1083279071 11:61614261-61614283 TCAGTCCCACTGGCAGACCAGGG + Intergenic
1086990922 11:93303400-93303422 TCAGGTACACACGGAGACCCAGG + Intergenic
1087056845 11:93945149-93945171 TCAGTCCCTGACTCAGACCCTGG - Intergenic
1202823687 11_KI270721v1_random:80297-80319 TCAGGACCACAGGCAGCTCCTGG - Intergenic
1091798367 12:3309850-3309872 TCAATACCACCCACAGACCCAGG - Intergenic
1092933930 12:13342526-13342548 ACAGTGCCACCCCCAGACCCTGG + Intergenic
1094355474 12:29573430-29573452 TCAGTACCACACACTGTGCCAGG + Intronic
1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG + Intronic
1100100086 12:91092310-91092332 TCAGTCACACACAGAGACCCAGG - Intergenic
1102028049 12:109724567-109724589 TCAGAAGCTCACGCAGGCCCCGG - Intronic
1104072475 12:125357803-125357825 TCAGAACCATCTGCAGACCCAGG + Intronic
1104477852 12:129084961-129084983 TCGGCAACACACGCAGCCCCTGG - Intronic
1108441374 13:50456542-50456564 TCACTTCCTCATGCAGACCCAGG + Intronic
1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG + Intergenic
1116317738 14:43418373-43418395 TCAGGCACACACGGAGACCCAGG - Intergenic
1126555239 15:49980181-49980203 TCAGTATCACCTGCAGACCTGGG - Intronic
1128528477 15:68428522-68428544 TCCATATCACAAGCAGACCCTGG - Intronic
1131056777 15:89379478-89379500 TCCGGACCACACTCAGCCCCAGG - Intergenic
1144952240 17:19000566-19000588 TCAGCACAACAGGCAGACCCTGG - Intronic
1147816512 17:43214519-43214541 TCAGAACCTCAGGCAGACCTGGG + Intronic
1154305537 18:13228093-13228115 TCAGCACCACACTCTGTCCCAGG + Intronic
1156855980 18:41781664-41781686 TCAGTACCCCAGCCAGGCCCTGG - Intergenic
1160807433 19:998645-998667 CCAGCACCTCTCGCAGACCCAGG + Intergenic
1161331096 19:3688145-3688167 TGGGGACCACGCGCAGACCCTGG - Intronic
1165819388 19:38665055-38665077 GCAGTACCACAGGCTGTCCCTGG + Intronic
1168714383 19:58518501-58518523 TCTGTGCCACACCCACACCCTGG - Intronic
925280823 2:2683265-2683287 TCACCACCACACACACACCCAGG - Intergenic
926684972 2:15691286-15691308 ACAGTACCATGCGTAGACCCAGG - Intronic
931439007 2:62274108-62274130 TCAGTCCCACAAGAAGTCCCAGG - Intergenic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
938417003 2:131111908-131111930 ACAGTACCACAATCAGACACTGG - Intronic
938917942 2:135963038-135963060 TCAGTGCTACACAAAGACCCTGG + Intronic
943551177 2:189340798-189340820 TCAGTGCCATTTGCAGACCCAGG + Intergenic
943613577 2:190065279-190065301 TCAGTGCCTCACCCAGTCCCTGG - Intronic
945125610 2:206506311-206506333 TCATTACCACATGCTGACCCTGG + Intronic
946966169 2:225040912-225040934 GCAGTACCACATGCTGTCCCTGG + Intronic
1175737333 20:61396342-61396364 TCAGTTCCATACACAGTCCCAGG - Intronic
1175920126 20:62446722-62446744 CCAGGCCCACAGGCAGACCCCGG - Intergenic
1175940517 20:62535573-62535595 TCAGGCCCACAGGCAGACGCAGG - Intergenic
1175992110 20:62794687-62794709 TCCGTCCCGCACCCAGACCCGGG + Intergenic
1177117555 21:17104676-17104698 TCAGTCACACACAGAGACCCAGG + Intergenic
1179261985 21:39765531-39765553 TCATTACCAGACCCAGAACCTGG - Exonic
1180122505 21:45763341-45763363 CCAGCACCGCACGCAGAGCCTGG - Intronic
1182007421 22:26972375-26972397 TCAGTACGAGACCCAGACTCAGG - Intergenic
1183569454 22:38641343-38641365 TCAGGACCCAATGCAGACCCAGG - Intronic
1184880188 22:47299674-47299696 ACAGAACCACCCGCAGAACCAGG + Intergenic
1185127609 22:49020181-49020203 CCAGAACCACATGCAGAGCCTGG - Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
1185427909 22:50783803-50783825 TCGGTACCACACCCACAGCCAGG - Intergenic
950033797 3:9869771-9869793 TCAGCACCAAAGCCAGACCCAGG + Intronic
950055791 3:10023449-10023471 TCAGCACCAAAGCCAGACCCAGG + Intergenic
953206460 3:40834278-40834300 TCAGCACCAGGGGCAGACCCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954693805 3:52409969-52409991 TCAGTCCCACACACAGACAACGG + Exonic
967965656 3:194958154-194958176 ACAGTCCCACACACAGCCCCAGG + Intergenic
968230059 3:197000264-197000286 TCAGTACCACCCCTAGACCTAGG - Intronic
968510038 4:991610-991632 TCAGCATCTCACGCAGACCCCGG + Exonic
977522863 4:98107632-98107654 TGAGTACCCCAGGCATACCCGGG - Intronic
982645955 4:158026091-158026113 TCAGGCACACACACAGACCCAGG + Intergenic
993940010 5:94047064-94047086 TCAGTACAACAAAAAGACCCAGG - Intronic
997283206 5:132661374-132661396 TCAGGAGCAGACGGAGACCCAGG + Intergenic
1002793685 6:453260-453282 TCAGGCTCACACGCAGACCGTGG - Intergenic
1006189903 6:32201346-32201368 TCAGTACCACCAGCAGGGCCAGG + Exonic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1007607214 6:43125588-43125610 CCAGGACCACTCCCAGACCCTGG - Intronic
1008568567 6:52793010-52793032 TCAGGAACACATGCACACCCAGG + Intronic
1008573019 6:52833013-52833035 TCAGGAACACATGCACACCCAGG + Intronic
1010524273 6:76881107-76881129 TAAGTACCATACTCAGTCCCTGG + Intergenic
1011253825 6:85401412-85401434 TTAGTACCAGATGCAGACTCAGG + Intergenic
1012989660 6:105912030-105912052 TCAGTTTCTCAAGCAGACCCAGG + Intergenic
1013657069 6:112257001-112257023 AAAGTACTACATGCAGACCCAGG - Intergenic
1015266035 6:131293420-131293442 TAAGGACCACACGGAGAACCTGG + Intergenic
1016408552 6:143757480-143757502 TGAGGACCACATGCAGCCCCAGG + Intronic
1018642446 6:165917151-165917173 TCCCGCCCACACGCAGACCCAGG + Intronic
1023185575 7:37529744-37529766 TCAGTGACACAGGCAGAGCCAGG + Intergenic
1024047020 7:45591835-45591857 TCAGAACCAGGCTCAGACCCAGG - Intronic
1024137064 7:46420266-46420288 ACAGAACCACAGGCAGACCTGGG - Intergenic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1035029169 7:155846227-155846249 TCACTACCCCAAGCATACCCAGG - Intergenic
1035485645 7:159223139-159223161 TATGTACCAGACGCAGATCCTGG + Intergenic
1035893662 8:3373290-3373312 TCCATACCACACACAGAACCCGG + Intronic
1036103163 8:5810035-5810057 TCATTAACACATGAAGACCCTGG + Intergenic
1039865040 8:41493036-41493058 TCAGTACCACAAGCAGTTCTGGG - Intronic
1041576888 8:59407848-59407870 TCAGTACCAAACACAGCACCTGG + Intergenic
1047141062 8:122140279-122140301 ACAGTACCAGAGGCAGATCCAGG + Intergenic
1047572464 8:126114562-126114584 TCAGTACCACCCACAGCCTCAGG + Intergenic
1058668918 9:107344249-107344271 TCAGTCCCAGACTCAGGCCCTGG - Intergenic
1059076258 9:111196936-111196958 TCAGTCACACACAGAGACCCAGG + Intergenic
1059263711 9:113005831-113005853 TCAGTGCCACCCACAGAACCTGG + Intergenic
1059543718 9:115155523-115155545 TCTTTAGCACACGAAGACCCAGG + Intronic
1185476080 X:416390-416412 TCCGTGCCAGACGCAGCCCCGGG - Intergenic
1189362867 X:40366730-40366752 TCAGGACCACATGCAGGCCTGGG - Intergenic
1201575349 Y:15456321-15456343 GCAGTAGCAGCCGCAGACCCGGG + Intergenic