ID: 1094493710

View in Genome Browser
Species Human (GRCh38)
Location 12:30976761-30976783
Sequence GCATCTGCAAGCATGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094493704_1094493710 22 Left 1094493704 12:30976716-30976738 CCAGGAGAGTGAATCCTCTGTCC 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1094493707_1094493710 1 Left 1094493707 12:30976737-30976759 CCAGACAACCTGTGCCTGCAGGC 0: 1
1: 0
2: 0
3: 15
4: 367
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1094493703_1094493710 23 Left 1094493703 12:30976715-30976737 CCCAGGAGAGTGAATCCTCTGTC 0: 1
1: 0
2: 0
3: 7
4: 185
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1094493708_1094493710 -7 Left 1094493708 12:30976745-30976767 CCTGTGCCTGCAGGCAGCATCTG 0: 1
1: 1
2: 4
3: 33
4: 394
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1094493705_1094493710 8 Left 1094493705 12:30976730-30976752 CCTCTGTCCAGACAACCTGTGCC 0: 1
1: 0
2: 0
3: 7
4: 163
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1094493702_1094493710 30 Left 1094493702 12:30976708-30976730 CCAGGGACCCAGGAGAGTGAATC 0: 1
1: 0
2: 1
3: 9
4: 266
Right 1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094493710 Original CRISPR GCATCTGCAAGCATGTCCTG AGG Intronic
900359786 1:2283012-2283034 TCATCTGCCAGCAGCTCCTGTGG + Intronic
900456649 1:2778139-2778161 GCAGCAGCAAGCATGGCCTCTGG + Intronic
902224444 1:14987910-14987932 TAACCTGCCAGCATGTCCTGTGG - Intronic
902295346 1:15463236-15463258 GCATTTTCAAACATGCCCTGGGG + Intronic
902625283 1:17672894-17672916 GCATCTCAAGGCATGTCTTGTGG + Intronic
902731786 1:18374530-18374552 GCATCTGCCAGCCAGTCGTGTGG - Intronic
903761255 1:25700445-25700467 GTTTCTGCAAGTTTGTCCTGAGG + Intronic
913960297 1:143333977-143333999 GCAGCTGCCAGCAGCTCCTGAGG + Intergenic
914054653 1:144159550-144159572 GCAGCTGCCAGCAGCTCCTGAGG + Intergenic
914124493 1:144806811-144806833 GCAGCTGCCAGCAGCTCCTGAGG - Intergenic
918108094 1:181430430-181430452 GCAGCTGCGGGCATGTCCTTAGG + Intronic
918559660 1:185849216-185849238 GCATGTGCAAAAATGCCCTGAGG - Intronic
920669788 1:207994631-207994653 GCTTCTGCAGTCATGTCATGTGG - Intergenic
922868963 1:228884564-228884586 GCAACAGCAAACATTTCCTGAGG - Intergenic
1064719839 10:18217868-18217890 GCAGGGGCAAGCATTTCCTGGGG - Intronic
1066169282 10:32824831-32824853 ACATCTGCAAGCATATTCTAAGG - Intronic
1067494107 10:46747002-46747024 GCATCTGCAACAGTGTACTGGGG + Intergenic
1069123729 10:64603464-64603486 TGATCTGCAAGCTGGTCCTGTGG + Intergenic
1073183763 10:101602912-101602934 TCATCTGCCAGCATATCCTCTGG + Intronic
1073805046 10:107088397-107088419 GCATCTGAAGGCAGGCCCTGGGG + Intronic
1077533134 11:3106574-3106596 TCATCTGCAGGCATGCTCTGGGG + Intronic
1078465571 11:11547616-11547638 GCTTGAGCAAGCAGGTCCTGTGG - Intronic
1084916289 11:72431523-72431545 GCATATGAAAGCCAGTCCTGTGG + Intronic
1088499654 11:110471059-110471081 GCCTCTCCTTGCATGTCCTGAGG + Intergenic
1090259614 11:125309319-125309341 GAATTTGAAAGCATGTCATGTGG - Intronic
1093540687 12:20280706-20280728 GCAACTGCAGGCATTTCCTAAGG + Intergenic
1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG + Intronic
1102083311 12:110115799-110115821 GCATCTGCATGGATGACCTCAGG + Intergenic
1102470699 12:113158277-113158299 CCAGCTGCAACCATGTCCAGTGG + Exonic
1102792641 12:115660077-115660099 GCATCTGCAGACATATCTTGGGG + Intergenic
1102935884 12:116896709-116896731 CCATCTCCAAGCAAGTACTGAGG - Intergenic
1103330707 12:120151902-120151924 GCACCTGCCAGCATGGCCTCGGG - Intronic
1110694325 13:78470411-78470433 GCATCTGCAGACATGTGGTGTGG + Intergenic
1112808934 13:103194931-103194953 CCATCTTCCAGCATGACCTGTGG + Intergenic
1113945757 13:114043224-114043246 GCACCTCCCACCATGTCCTGTGG - Intronic
1114362319 14:21988235-21988257 TCATCTGCAAAGATGTTCTGTGG + Intergenic
1118265889 14:64294620-64294642 GCATTTCCAACCAGGTCCTGGGG + Intronic
1120010238 14:79405481-79405503 GCATCTTCTAGAATCTCCTGTGG - Intronic
1121621073 14:95348670-95348692 GCATCTGAAAGGATGTCCAAAGG - Intergenic
1121718525 14:96093155-96093177 GCAACTCCCAGCATGTCATGTGG + Exonic
1122299510 14:100723880-100723902 CCATTTGCAAGCAGATCCTGGGG - Intergenic
1122836337 14:104432728-104432750 GCATCTCCAAGGATGTCCCCAGG - Intergenic
1124023368 15:25943659-25943681 GCATCTGAAAGAATGAACTGGGG - Intergenic
1124355934 15:28994835-28994857 GCACCTGCAATCTGGTCCTGGGG - Intronic
1124441295 15:29688050-29688072 GTATCTGCGAGCATGGGCTGGGG + Intergenic
1126681422 15:51205772-51205794 GCATCTGCAAGCTGGGCTTGTGG - Intergenic
1126960420 15:53987617-53987639 TCATTTGCAAAAATGTCCTGAGG + Intergenic
1129652795 15:77503523-77503545 GCATCAGAGAGCATCTCCTGAGG - Intergenic
1130272394 15:82458842-82458864 GCAGCTGGAAGAATGGCCTGAGG + Intergenic
1130380050 15:83363873-83363895 GTACCTGTAAGCATGTTCTGAGG - Intergenic
1130464745 15:84186195-84186217 GCAGCTGGAAGAATGGCCTGAGG + Intergenic
1130487940 15:84408609-84408631 GCAGCTGGAAGAATGGCCTGAGG - Intergenic
1130499521 15:84487342-84487364 GCAGCTGGAAGAATGGCCTGAGG - Intergenic
1130587037 15:85190809-85190831 GCAGCTGGAAGAATGGCCTGAGG + Intergenic
1131796651 15:96024580-96024602 GCACCTGCAACCATGGCCTCAGG + Intergenic
1133057313 16:3152052-3152074 GCAGCTGCAGGCATGGCCTCCGG + Intergenic
1135173673 16:20209259-20209281 CCATCTCCAAAGATGTCCTGAGG - Intergenic
1135719040 16:24799051-24799073 GCATCTACCAGCATGCCCTCTGG - Intronic
1136549919 16:30977567-30977589 GCTTCAGCATGCATGTCCTCGGG - Intronic
1140289471 16:73638881-73638903 GCATCTGAAAGTAGGTCTTGGGG + Intergenic
1141426994 16:83951188-83951210 GCATCTGCCAGCAGGGGCTGGGG - Exonic
1141710819 16:85698035-85698057 GCATCTCCAACCAGCTCCTGGGG - Intronic
1143244212 17:5469023-5469045 GCATCTCCCAGCATGCCTTGGGG + Exonic
1145272896 17:21414045-21414067 GAAGCTGCAAGCATGGCATGTGG + Intronic
1145311105 17:21701508-21701530 GAAGCTGCAAGCATGGCATGTGG + Intronic
1146804669 17:35855739-35855761 GCCTCTGCCAGGGTGTCCTGGGG - Exonic
1149376425 17:56048577-56048599 GAAGCTGCAGGCCTGTCCTGAGG - Intergenic
1150132355 17:62675982-62676004 GCATCTGCCATCATGCCCAGAGG + Intronic
1150629163 17:66866026-66866048 GCATCTGCAAGAATTTTCTCAGG - Intronic
1151746093 17:76012629-76012651 GTATCTGCGAGCATCACCTGGGG + Intronic
1153607495 18:6848811-6848833 GCTTCTGTTTGCATGTCCTGAGG - Intronic
1156500561 18:37554752-37554774 ACACCTGGAAGGATGTCCTGGGG - Intronic
1163400212 19:17087562-17087584 GCAACTGGATTCATGTCCTGGGG + Intronic
1163791904 19:19311763-19311785 GGATCTGCAAGCATTTCTTTGGG - Intronic
1166261021 19:41640842-41640864 GCTTCTCAAAGCATGTTCTGGGG - Intronic
1167662241 19:50802423-50802445 CCCTCTGCAACCAGGTCCTGAGG + Intronic
1167773473 19:51538460-51538482 GCATTTTCAAGCTTGTCCTCTGG - Intergenic
1168146093 19:54420749-54420771 GCAGCTGCCACCATCTCCTGGGG - Intronic
1202694134 1_KI270712v1_random:112228-112250 GCAGCTGCCAGCAGCTCCTGAGG + Intergenic
925527276 2:4816766-4816788 GCATCTGCTTTCATCTCCTGTGG + Intergenic
928428974 2:31202272-31202294 GCATCTGCATGAATCTACTGGGG + Intronic
928628606 2:33167605-33167627 GCATCTTCAAGAATGGCCTTAGG + Intronic
933761346 2:85674347-85674369 GCAGCTGCATGCATTTCCTAGGG - Intergenic
933952425 2:87342347-87342369 GCAGCTGCCAGCAGCTCCTGAGG - Intergenic
934236667 2:90238684-90238706 GCAGCTGCCAGCAGCTCCTGAGG - Intergenic
934899444 2:98146332-98146354 CTATCTGCAGGCATGTCCTAGGG + Intronic
934955765 2:98617071-98617093 AAATCTGCAAACATGTCCTGAGG - Intronic
936039155 2:109136241-109136263 ACATCAGCAAGCATTTGCTGGGG + Intronic
938096588 2:128467880-128467902 GGACCTGCAAGCCAGTCCTGTGG + Intergenic
939736473 2:145853743-145853765 GCATCTACAATCAGGTTCTGTGG + Intergenic
944913379 2:204332365-204332387 CCATGTGCAAGCATGTCTTTAGG + Intergenic
946436460 2:219659523-219659545 GCATCTGCCAGGAAATCCTGGGG + Intergenic
948866347 2:240776755-240776777 GCATCTGCGTGCATGTCCTGGGG - Intronic
949006068 2:241648824-241648846 GCACCTGCAAGCATCTCCCTCGG - Intronic
1170944391 20:20877924-20877946 GCATCTCCCAGCATCCCCTGTGG + Intergenic
1172128091 20:32637064-32637086 GCGTCAGCAAGCCTGTCCTTGGG - Intergenic
1172737343 20:37137232-37137254 GCATCTGCCACCATGCCCGGGGG + Intronic
1174464270 20:50705094-50705116 GCATCTTCAAGCACCTCCTTTGG + Intergenic
1175457512 20:59126663-59126685 CCATATGCATGCATGGCCTGAGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1176207954 20:63900629-63900651 GCATATGCAGGTCTGTCCTGAGG - Intronic
1176263487 20:64195963-64195985 GCCACTGCGAGCATGTCTTGAGG - Intronic
1178705777 21:34871683-34871705 GCATCTGCAAGCCCATCCTGTGG + Intronic
1182896066 22:33860553-33860575 TCAGCAGCAAGCATGGCCTGAGG + Intronic
1183132851 22:35856232-35856254 GCATCATCAACCATGTCCTCTGG - Intronic
1183721301 22:39563050-39563072 GCATCTGCAGGGCTGTCATGCGG + Intergenic
1184712376 22:46259906-46259928 GCATCTGCAAGAATGTAGTAAGG - Exonic
1185109940 22:48895191-48895213 GCATCTGCACACACGGCCTGGGG - Intergenic
950181901 3:10919350-10919372 TCACCTACAAGCATGTCCAGTGG + Intronic
955760324 3:62273103-62273125 GCATTTGCCAGAATGTCGTGAGG - Intronic
956039546 3:65131742-65131764 GCATCAGCAATCTTGTCCTGTGG - Intergenic
956848507 3:73206190-73206212 CCATCTGCCACCATGCCCTGGGG - Intergenic
961007763 3:123416269-123416291 GCGTCTGGAAGTAAGTCCTGAGG - Intronic
962351645 3:134660725-134660747 GAGTGTGCAAGCTTGTCCTGTGG + Intronic
965549100 3:169946340-169946362 GCAACTGCAAGCAAGTCATGGGG - Intergenic
968921296 4:3523479-3523501 GCATCAGCAGACATGTCATGTGG - Intronic
969343441 4:6556788-6556810 GAATCTGCAAGCATCTCTCGGGG + Intronic
969907234 4:10408584-10408606 GGATCAGCATGCATGACCTGTGG + Intergenic
973724648 4:53763372-53763394 GCTTCTCCAAGAGTGTCCTGTGG + Intronic
973745047 4:53956062-53956084 GCATCTGGCAGAATGCCCTGTGG + Intronic
976073808 4:81273563-81273585 GCATCAGCAACAATTTCCTGAGG + Intergenic
978904654 4:113991392-113991414 GTATCTCCAAGCATATTCTGTGG - Intergenic
980576422 4:134688162-134688184 ACATCTGCTAGCTTCTCCTGGGG - Intergenic
981531326 4:145756381-145756403 GCATCTCCAAGCCAGTCATGAGG - Intronic
988739926 5:34060005-34060027 AAATCTGCAATCAGGTCCTGAGG - Intronic
988945969 5:36199984-36200006 ATAACTGCAAACATGTCCTGGGG - Intronic
992840642 5:80688154-80688176 ACATGTGGAAGAATGTCCTGTGG + Intronic
996277200 5:121681334-121681356 GCAGCTGCAAGCATGTCTTAAGG - Intergenic
997183416 5:131857505-131857527 TCATCTGCCAGCCTCTCCTGGGG + Intronic
998668599 5:144327910-144327932 ACATCTGCAAGTATGTCTTCAGG + Intronic
999614593 5:153408790-153408812 GCATCATCAGTCATGTCCTGTGG + Intergenic
1002124918 5:177035778-177035800 GCACCTGCCACCATGCCCTGGGG + Intronic
1002430255 5:179199273-179199295 GCAGCTGAAAGCCTGTCCTGGGG - Intronic
1002567830 5:180121815-180121837 GCGTCCGCAAGCATCTCCAGAGG + Intronic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1004019190 6:11761121-11761143 TCTTCTGCCAGAATGTCCTGTGG + Intronic
1009473355 6:64056343-64056365 ACATGTGCAAACAAGTCCTGAGG - Intronic
1010015512 6:71101464-71101486 GCATCTGCAGTGATGTACTGGGG + Intergenic
1013275347 6:108579655-108579677 GCCTCTGCTTGCATGTTCTGGGG + Intronic
1014671215 6:124306077-124306099 GAATCTGCAAGGATTTGCTGAGG + Intronic
1016426530 6:143941710-143941732 GCATCTGCAGGCAGCTCCTTGGG + Exonic
1017553893 6:155542369-155542391 GCATCTGCAAGAGTGTCAGGAGG + Intergenic
1018859768 6:167703119-167703141 GCAGCTGCAGGCAGGTCCTGTGG - Intergenic
1018916121 6:168133485-168133507 GCATCTGCAGGCTTATCCAGGGG - Intergenic
1018933635 6:168259068-168259090 GCATCCGCACGCATGAGCTGTGG - Intergenic
1018934711 6:168266142-168266164 GCAACGGCAAGCCTGACCTGTGG - Intergenic
1019909087 7:4087855-4087877 CCATCTGCAAGGTTGTCATGAGG + Intronic
1020430553 7:8112779-8112801 GCATGTGGAACCATCTCCTGGGG + Intergenic
1022030426 7:26487469-26487491 GCATTTGAAAGCATGAACTGGGG - Intergenic
1023890238 7:44386709-44386731 GCATCTGCAAGGATGCAGTGGGG - Intronic
1026876471 7:73881865-73881887 GCATCTCCCAGCATGCCCTGGGG - Intergenic
1029687271 7:102157390-102157412 ATGTCTGCAAGCAGGTCCTGAGG - Intronic
1032516482 7:132509848-132509870 GCAGCTGCAACCAGGTCCTCTGG + Intronic
1033172821 7:139098889-139098911 GTATCTGCGAGCTTTTCCTGCGG - Intronic
1033841966 7:145386225-145386247 GCATCTGGAAGCTTATCCTGGGG - Intergenic
1034352872 7:150428665-150428687 GGACCTGCAAGCAAGTCCAGTGG - Intergenic
1035349987 7:158238925-158238947 GCATAGGCCAGCCTGTCCTGGGG - Intronic
1037496635 8:19447068-19447090 GAATCTGCACGCCTGCCCTGTGG + Intronic
1041210715 8:55548421-55548443 CCATCTGCCACCAAGTCCTGTGG + Intergenic
1041744131 8:61187995-61188017 GCATCTGGAAGCTAGTCCTGAGG + Intronic
1043859192 8:85296264-85296286 GAATCTGCTAGCAAGTCCTGTGG + Intergenic
1046161406 8:110370873-110370895 GTATCTGCTGGCATGTTCTGTGG - Intergenic
1049290047 8:141797088-141797110 GCATCTCCACGCTGGTCCTGAGG - Intergenic
1050866915 9:10512438-10512460 GCATCTTCAAGCCTTTCCTCCGG - Intronic
1056114559 9:83429450-83429472 GCATTTTTAAGGATGTCCTGGGG - Intronic
1057922919 9:99113270-99113292 ACATCAGCAACCATGACCTGAGG - Intronic
1061034747 9:128107296-128107318 GCCTCTTCAAACATATCCTGCGG + Exonic
1061042817 9:128149681-128149703 GCACCTGCAGGCAGGGCCTGGGG + Intronic
1061993212 9:134171234-134171256 GCATCTCCCAGCATCTCCTGGGG - Intergenic
1062135275 9:134923608-134923630 TCATCTGCATGCAGCTCCTGGGG - Intergenic
1062403823 9:136384079-136384101 GGAACAGCAAGCCTGTCCTGGGG - Intronic
1062463106 9:136670052-136670074 GCACCTCCTTGCATGTCCTGGGG + Intronic
1187237699 X:17483905-17483927 TCTTCTGAAAGCCTGTCCTGTGG + Intronic
1188281212 X:28271985-28272007 GCATGTACAGGAATGTCCTGGGG - Intergenic
1192142189 X:68655184-68655206 GGATCTGCAATAGTGTCCTGAGG - Intronic
1192949355 X:76000154-76000176 GCATGTGCAAAGATTTCCTGAGG - Intergenic
1193509728 X:82384208-82384230 GTGACTGCAAGCCTGTCCTGGGG + Intergenic
1193779374 X:85683742-85683764 GCATCTCCAAGCCTGTCCCCAGG + Intergenic
1194483190 X:94453311-94453333 GCCTCTGCAGGCTTGGCCTGAGG + Intergenic
1195330174 X:103790889-103790911 GAATTTTCAAGCATCTCCTGAGG + Exonic
1195419031 X:104653124-104653146 GCTTCTCCAAGCATCTCCTCTGG + Intronic
1198169698 X:134093652-134093674 GCAGCTGCATCCATGTCCTTGGG + Intergenic
1202370473 Y:24192478-24192500 GCAGCTGGAAGAATGGCCTGAGG - Intergenic
1202500311 Y:25477639-25477661 GCAGCTGGAAGAATGGCCTGAGG + Intergenic