ID: 1094494681

View in Genome Browser
Species Human (GRCh38)
Location 12:30982041-30982063
Sequence CCCAGACCCGCCCATGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094494681_1094494690 12 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494690 12:30982076-30982098 CAAAGCCTGAATGGGGGCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 209
1094494681_1094494688 6 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494688 12:30982070-30982092 AGACTTCAAAGCCTGAATGGGGG 0: 1
1: 0
2: 1
3: 12
4: 152
1094494681_1094494686 4 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494686 12:30982068-30982090 TGAGACTTCAAAGCCTGAATGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1094494681_1094494689 11 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494689 12:30982075-30982097 TCAAAGCCTGAATGGGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 230
1094494681_1094494692 26 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494692 12:30982090-30982112 GGGCCTGGGAGCCTCTGACCAGG 0: 1
1: 1
2: 3
3: 43
4: 430
1094494681_1094494687 5 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494687 12:30982069-30982091 GAGACTTCAAAGCCTGAATGGGG 0: 1
1: 0
2: 0
3: 12
4: 149
1094494681_1094494685 3 Left 1094494681 12:30982041-30982063 CCAGTGCCATGGGCGGGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1094494685 12:30982067-30982089 CTGAGACTTCAAAGCCTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094494681 Original CRISPR CCCAGACCCGCCCATGGCAC TGG (reversed) Intronic
900470023 1:2849141-2849163 CACACTCCCGCCCAGGGCACAGG - Intergenic
900470033 1:2849173-2849195 CACACTCCCGCCCAGGGCACAGG - Intergenic
900470042 1:2849205-2849227 CACACTCCCGCCCAGGGCACGGG - Intergenic
900470142 1:2849553-2849575 CACACTCCCGCCCAGGGCACAGG - Intergenic
900470169 1:2849649-2849671 CACACTCCCGCCCAGGGCACAGG - Intergenic
900497612 1:2983079-2983101 CCCAGCCCCGGCCCTGGCCCTGG - Intergenic
900570121 1:3354018-3354040 CCCAGCCACGCCCATGGAACCGG + Intronic
900783396 1:4632261-4632283 CCCAGAGCCTCACATGGCATAGG - Intergenic
901304477 1:8222843-8222865 CACAGACCAGTCCATGGCCCAGG - Intergenic
901703068 1:11055761-11055783 CCCAGACACCCCCATCTCACCGG + Exonic
903193689 1:21669902-21669924 CCCACACCCGCCCTGGGCCCGGG - Intergenic
903281988 1:22255319-22255341 CCCAGACCTGCCCTGGGCTCTGG + Intergenic
903373820 1:22853525-22853547 CCCAGACCCAGCCCTGGCAGGGG + Intronic
903605505 1:24572538-24572560 TCCAGAGCCGGCCCTGGCACGGG - Intronic
905462204 1:38129212-38129234 CCCAGGCCCGGCCAAGGCCCAGG + Intergenic
906292809 1:44631113-44631135 CCCAGAGCCCAGCATGGCACTGG - Intronic
911161847 1:94689172-94689194 CCCAGACCCTCACCTGCCACTGG + Intergenic
914665578 1:149829716-149829738 CCAAGACCTGCCCATGGCCCTGG - Intergenic
914670187 1:149864078-149864100 CCAAGACCTGCCCATGGCCCTGG + Intronic
914755885 1:150561407-150561429 CTCAGCCCCGCCCAGGGCCCTGG - Intergenic
918432574 1:184477262-184477284 CACAGACCCACCCATCGCACTGG - Intronic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
1069557035 10:69405199-69405221 CCAAGAGCCTCCCATGGCTCAGG + Intronic
1075711020 10:124530567-124530589 CCCAGACCCCCCCACGCCCCAGG + Intronic
1076434833 10:130433180-130433202 CCCAGACCCTTCCTTGGCAATGG - Intergenic
1077197577 11:1289004-1289026 CCCAGACCTGGCCCTGGCCCTGG - Intronic
1077405477 11:2380630-2380652 CCGAGACCCACCCAAGGGACAGG - Intronic
1077429828 11:2510873-2510895 CCCAGACCAGGCCATGCCTCAGG + Intronic
1077501847 11:2912897-2912919 CCCTGGCACCCCCATGGCACCGG - Intronic
1081549048 11:44095725-44095747 CCCAGACTCGGCCCTGGCAGTGG + Intronic
1081789296 11:45771647-45771669 CCCAGAGCCTTCCACGGCACTGG - Exonic
1083338880 11:61945878-61945900 CCCAGTCCTGCCCATGACAACGG - Intergenic
1083367221 11:62148593-62148615 TCCAGACCCGCCCACAGCTCAGG - Intronic
1083750899 11:64760032-64760054 CCAAGACCCTCCCATTGCAGGGG - Exonic
1084419380 11:69052734-69052756 CCATGACCCGCCCACGCCACTGG - Intronic
1084531232 11:69728986-69729008 CCCAGCCCCGCCAATGCCAGGGG - Intergenic
1089078773 11:115759759-115759781 CCCAAACCCGCCCAAGGTAGAGG - Intergenic
1090605913 11:128422837-128422859 CCCTCCCCCTCCCATGGCACTGG - Intergenic
1090798998 11:130159379-130159401 ACCAGAACCGCCCCTGGCCCAGG - Intergenic
1090867008 11:130709929-130709951 CCCTGACCTTCCCAAGGCACAGG - Intronic
1091128048 11:133119507-133119529 CGCAGCCCAGCCCAGGGCACTGG + Intronic
1091230231 11:133983616-133983638 CCGTGGCCCGCCCATGCCACGGG - Intergenic
1094494681 12:30982041-30982063 CCCAGACCCGCCCATGGCACTGG - Intronic
1095983349 12:47984854-47984876 CCCACTGCCACCCATGGCACAGG + Intronic
1097190340 12:57216625-57216647 CCCGGACACGCCCCTGGCCCAGG - Intergenic
1102997794 12:117362925-117362947 CCCAGGCCCATCCATGGCTCAGG - Intronic
1104640925 12:130466484-130466506 CCCAGAAGTGTCCATGGCACTGG + Intronic
1104717536 12:131026050-131026072 CCCAGACACACTGATGGCACTGG - Intronic
1104778116 12:131403172-131403194 GCCAGGCCCCCCCGTGGCACGGG + Intergenic
1105459260 13:20568091-20568113 CCCCGGCCCGCACGTGGCACAGG - Intronic
1106125193 13:26895470-26895492 CCCAGCCCGGCCCACGGCAGAGG - Intergenic
1106230419 13:27817109-27817131 CCCAGGCCAGCCCATGGAGCTGG + Intergenic
1113512482 13:110867219-110867241 CCCACACCTCCCCATGCCACAGG + Intergenic
1117722464 14:58640939-58640961 CCCAGACCTGCAAATGGCAATGG + Intronic
1119558519 14:75571615-75571637 TCTAGACTCCCCCATGGCACAGG + Intergenic
1120941619 14:89955549-89955571 CCCAGCCCCTCCCAGGACACAGG + Intronic
1121449235 14:93996924-93996946 CTCAGCCCCACCCATGGCTCAGG - Intergenic
1121482817 14:94291630-94291652 CCCAGACCCTCCCAGGGCAGTGG - Intronic
1121607836 14:95254211-95254233 CCCAGCCCCACCCATGACCCAGG + Intronic
1122056018 14:99098899-99098921 CCCCGACTCCCCCACGGCACAGG + Intergenic
1122308284 14:100779171-100779193 GCCACACCCTCCCATGGCAGGGG - Intergenic
1122319203 14:100843635-100843657 CCAAGACCCGGCCAGGGCACTGG - Intergenic
1122780409 14:104141067-104141089 CCCAGGCCCGCACAGGGGACAGG - Intronic
1122793368 14:104193667-104193689 TCCCGACCCTGCCATGGCACTGG - Intergenic
1124712604 15:32028500-32028522 CACAGACCTACCTATGGCACAGG + Intergenic
1126150773 15:45522340-45522362 GCCAGAGCCGGCCATGGCAGAGG + Exonic
1132002909 15:98197736-98197758 CCTAGACCCTCCCATAGTACAGG + Intergenic
1132038622 15:98506294-98506316 CGCAGACACGCCTACGGCACAGG + Intronic
1132248926 15:100318872-100318894 GACAACCCCGCCCATGGCACAGG + Intronic
1132583035 16:694075-694097 CCCAGCCCCGCCCCGGGCAGGGG - Exonic
1132614563 16:833681-833703 CCTAGACCCGGCCAAGGCTCTGG - Intergenic
1135607715 16:23837396-23837418 CCCAGAGCCTACCTTGGCACTGG - Exonic
1139526123 16:67518022-67518044 CCCAGGCCCACCTCTGGCACAGG + Intergenic
1141435484 16:83997411-83997433 CCCAGACCCTGCCCTGGCACAGG + Intronic
1141763572 16:86044527-86044549 CCCAGATACGCCTATTGCACTGG + Intergenic
1141763929 16:86046402-86046424 CCGAGCCCAGCCCCTGGCACAGG - Intergenic
1142002692 16:87672391-87672413 CCCAGCCGCGCCCTTGGCAGGGG + Intronic
1142551850 17:745613-745635 CCCAGGCCCACCCAGGGTACGGG - Exonic
1143573263 17:7774699-7774721 TCCAGATCCGCCCAGGGCAGTGG + Intronic
1144451810 17:15387014-15387036 CCCAGCCCTGCCCTTGGCCCTGG - Intergenic
1147421951 17:40326253-40326275 CCCAGACCAGAGCTTGGCACAGG - Intronic
1148070371 17:44905204-44905226 CCCAGACCTGCCCATGAAAATGG - Exonic
1148237879 17:45981539-45981561 CACAGACAAGCCCTTGGCACAGG - Intronic
1148682306 17:49481523-49481545 TCCAGCCCCTCCCCTGGCACTGG - Intergenic
1151936505 17:77265228-77265250 CCCAACCCCACCCATGGCACGGG + Intergenic
1152218891 17:79050018-79050040 CCCAGACCCACCCAGGCCCCAGG - Intergenic
1152226857 17:79096783-79096805 GCCAGCCCCGCCCATGGGACTGG + Intronic
1152290288 17:79436457-79436479 CCCTGTCCCGCCCATGGGGCTGG - Intronic
1153239348 18:3016300-3016322 TGCAGACCTGGCCATGGCACAGG + Intergenic
1153843369 18:9026989-9027011 ACCAGCCCGGCCCAGGGCACAGG - Intergenic
1155479743 18:26272387-26272409 CCTATACCCGCCCGCGGCACAGG + Intronic
1157114663 18:44851821-44851843 CCCAGAGAGGCCCATGGCCCAGG - Intronic
1158954056 18:62523279-62523301 CCGAGACCCGCCCCCGGCCCCGG + Exonic
1160739594 19:679838-679860 CCCAGACTCGCGCCTGGCAAGGG + Intronic
1161007384 19:1943337-1943359 CCCAGACCTGCCCAGAGCCCAGG - Intronic
1161221730 19:3120937-3120959 CCCAGCCCGGCCCAGGGCAAGGG - Intronic
1161592408 19:5134746-5134768 CCCAGACCCGGCCGGCGCACAGG - Intronic
1161618828 19:5287571-5287593 CCTGGACCCGCCCAGGGCATGGG - Intronic
1162794162 19:13078150-13078172 ACCAGAACCTCCCATGGCCCCGG + Intronic
1162831427 19:13286866-13286888 CCAAGACCCACCCCTGGCAGAGG - Exonic
1162918042 19:13884755-13884777 CCTAAACCCGCCCATGCCCCAGG + Intronic
1165256066 19:34577820-34577842 CCCAGCCCCTCCCATGGTGCTGG + Intergenic
1166328631 19:42066187-42066209 CCCAGTCCCGCCCCTGTCTCTGG + Intronic
1166376528 19:42330636-42330658 CCCAGACCCGGGCTTGGCAAAGG - Intronic
1166815333 19:45541353-45541375 CCCAGACCCCCCTATAGTACAGG - Intronic
1167149805 19:47702089-47702111 GCCAGCGCCGCCCAAGGCACCGG + Exonic
1167166672 19:47803656-47803678 CCCAGGCCCTCCCCTGGCCCTGG - Exonic
1167175165 19:47860108-47860130 CCCAGGCCCTCCCCTGGCCCTGG + Intergenic
1168489369 19:56795391-56795413 CCCAGCCCCGCCCAGGCCCCTGG + Intronic
1168682724 19:58327527-58327549 CCCACACCCTCCCAGGCCACTGG - Intronic
925922211 2:8645542-8645564 CCCAGGCCAGCCCAGGCCACGGG + Intergenic
928463974 2:31502750-31502772 CCAAGTCCCTCCCATGACACGGG + Intergenic
929775554 2:44929005-44929027 CCCACACCCGCACGGGGCACCGG + Intergenic
930613304 2:53566926-53566948 CCCAGACCTGGCCATAGCATTGG + Intronic
932442596 2:71747214-71747236 CCCAGCCCCGCCCTGGGCCCAGG + Intergenic
933996759 2:87675794-87675816 CCCAGGCCTGCCCACAGCACTGG - Intergenic
934655604 2:96115508-96115530 CCCAGGCCCCCCCTTGGCCCTGG + Exonic
934949257 2:98565262-98565284 GCCAGACCCTCCCATTACACAGG - Intronic
941978580 2:171431743-171431765 CCCACTCCCGCCCATGGCCCTGG - Intronic
945066189 2:205949655-205949677 CCCAGACCTCCCCATGGCCTAGG + Intergenic
946174367 2:217913464-217913486 CCCCGACCTGGCCAGGGCACTGG + Intronic
946237494 2:218332979-218333001 CCCAGAACCGTCCATGCCGCTGG + Intronic
947378386 2:229520957-229520979 GCCAGACCCTCCCTTGGCATAGG - Intronic
947857366 2:233333263-233333285 CCAAGACCCCTCCAGGGCACAGG - Intronic
948495209 2:238344301-238344323 CCCAGAGCCGCCCATGGGGGAGG + Intronic
948857026 2:240735023-240735045 GCCAGCACCGTCCATGGCACAGG + Intronic
1169486846 20:6041486-6041508 CCCAGACCCGCCCAGGCTGCAGG - Exonic
1170567483 20:17615306-17615328 CCGGGACCTGCCCTTGGCACTGG - Intronic
1170959451 20:21012228-21012250 CCCTGGCCCGCCCATGAAACTGG + Intergenic
1171417783 20:24995128-24995150 CCCACACCCAACCCTGGCACTGG + Intergenic
1171463083 20:25309707-25309729 CACAGACCCACCCAGGCCACTGG + Intronic
1172111106 20:32545557-32545579 CCCCGACCCGCCCACAGCCCTGG + Intronic
1172170800 20:32930774-32930796 CCAAGACCCGCTCCTGTCACTGG - Intronic
1172443203 20:34979817-34979839 CCCCACCCCGCCCATGGCCCGGG - Intronic
1173881106 20:46412824-46412846 CCCAAACCCGCCCCAGGCTCTGG - Intronic
1174056511 20:47802078-47802100 CCCAGCCCAGGCCATGGCTCGGG + Intergenic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1175924366 20:62464810-62464832 CCCAGGCCAGCCCATGTCAGGGG - Exonic
1176123411 20:63464380-63464402 CCCAGCCCCTCACCTGGCACGGG + Intronic
1176857663 21:13985181-13985203 CCCTGGCCCTGCCATGGCACTGG + Intergenic
1177362733 21:20094402-20094424 ATCAGACCCGTCCATAGCACCGG - Intergenic
1178513811 21:33229856-33229878 CCAGGACCCGCCCCTGGCTCCGG + Intergenic
1178818551 21:35953963-35953985 CCCAAACCTGCCCCTGGCAATGG + Intronic
1180067358 21:45419051-45419073 CCCTGACCCGCCACTGACACTGG - Intronic
1180954001 22:19733346-19733368 CCCAGACCCCCACCTGGCAGAGG + Intergenic
1181747571 22:24966440-24966462 CCCAGCCCTGCCCAGGGCACTGG - Intronic
1181766335 22:25094812-25094834 CCCAGATCCACCCAGGACACAGG - Intronic
1183273204 22:36874760-36874782 CCCAGACCCGGCCATGGCCTGGG - Intronic
1184731482 22:46373403-46373425 CCCCGCCCCGCCCAGAGCACTGG - Intronic
1185172943 22:49304158-49304180 CCCCGACCTGGCCATGCCACAGG + Intergenic
950577193 3:13839254-13839276 CCCAGACCCACACATGGAACCGG + Intronic
951226494 3:20127101-20127123 CCCTGACCCCTCCTTGGCACTGG + Intronic
953901213 3:46845293-46845315 CCCAGCCCTGCCCAGGGCCCTGG - Intergenic
954385203 3:50240473-50240495 CCCAGTTCCACCTATGGCACTGG + Intronic
954690981 3:52395451-52395473 CCCTGACCTGCCCCTGGCCCAGG - Exonic
956737169 3:72246847-72246869 CCCTGGCCCGAGCATGGCACAGG + Intergenic
961370116 3:126423732-126423754 CCCACACCCGTCCGTGGCCCTGG + Intronic
968968414 4:3781111-3781133 CCCTGAGCCGCCCACGGCTCTGG + Intergenic
969453449 4:7287753-7287775 CCCACGCCCGCCCACAGCACGGG - Intronic
969458364 4:7313943-7313965 CCCAGAGCCCACCATGCCACAGG + Intronic
970691918 4:18630519-18630541 GCCAGCTCCGCCCATGGCCCTGG - Intergenic
970987083 4:22171315-22171337 CCCGGTCCCGCCCTTGACACAGG + Intergenic
971202315 4:24521964-24521986 CCCAGTCTCTCCCATGACACAGG + Intronic
980180231 4:129392775-129392797 CCCAGTCCTGTCCATGGGACTGG - Intergenic
981589827 4:146347786-146347808 CCCTGACAGGCCCATGACACTGG - Intronic
981935972 4:150240334-150240356 CCAAGACCCTTCCATGGTACTGG - Intronic
983561283 4:169104172-169104194 CCCAGACTCTCCCTAGGCACTGG - Intronic
988708277 5:33747058-33747080 CCCTGACTGGCACATGGCACTGG + Intronic
989178877 5:38556709-38556731 CCCTGACCCGCCCCTGCCCCCGG + Intronic
995354380 5:111222279-111222301 CACAGACCAGCCCATGGCCTGGG - Intergenic
995845074 5:116484853-116484875 CTCCGATCAGCCCATGGCACAGG + Intronic
996028975 5:118684091-118684113 CCTAGACCCACCCATGGCTGTGG + Intergenic
999144897 5:149385864-149385886 CCCAGAGCCGCTCCTGGCAGAGG + Intronic
999559236 5:152782292-152782314 CCTAGAGCAGCCCATGGCTCTGG - Intergenic
1001526609 5:172433604-172433626 GCCAGCCCAGCCGATGGCACAGG + Intronic
1001663113 5:173411334-173411356 CACAGACACGGCCCTGGCACAGG - Intergenic
1001902366 5:175443061-175443083 CCCAGTCCCGTCCATGGCAGAGG + Exonic
1001962078 5:175885600-175885622 CCCAGATCCGCCCATACCCCTGG + Intergenic
1002613006 5:180433587-180433609 CCCACACCTGCCCAGGGAACTGG + Intergenic
1002632516 5:180590996-180591018 CCCAGACCCGCCTGTGTCCCGGG - Intronic
1002710483 5:181192028-181192050 CCCCGCCCCGCCCAAGGCCCGGG - Intergenic
1003263471 6:4546389-4546411 CCCAGACACAGCCATGGCAGTGG - Intergenic
1003939082 6:11006244-11006266 CCCAGATCTGGCCATGGGACTGG + Intronic
1010037735 6:71345493-71345515 CCCAGAGCTGGGCATGGCACTGG + Intergenic
1010803459 6:80205780-80205802 CACACACACACCCATGGCACAGG - Intronic
1014010483 6:116469809-116469831 CCGATACCAGCCCATGGCCCAGG + Intergenic
1017005656 6:150026658-150026680 CCCAGGTCCACCGATGGCACAGG + Intergenic
1018753823 6:166831067-166831089 CCCAGACCCTCCAGTGGCAGGGG + Intronic
1019358945 7:594994-595016 CCCAAACCGGCCCAGGGAACTGG + Intronic
1019700283 7:2471506-2471528 CCCAGTCCCGCCCAGGGCCAGGG + Intergenic
1024954526 7:54902632-54902654 CCCAGGCCTTTCCATGGCACTGG - Intergenic
1025236484 7:57238082-57238104 CCCAGCCCAGGCCATGGCTCGGG - Intergenic
1027747029 7:82089067-82089089 CCCAGACCGGTCCATGGCCCAGG + Intronic
1032543857 7:132726040-132726062 GCCAGACCCCACCCTGGCACTGG + Intronic
1034973711 7:155435997-155436019 CCCAGCCTCCCCCATGACACTGG + Intergenic
1037592817 8:20327786-20327808 CACAGACCTGCCCTTGTCACTGG + Intergenic
1039715746 8:40106945-40106967 CCCAAACCAACCCTTGGCACTGG + Intergenic
1047784284 8:128138629-128138651 CCCAGACAAGGCCATGGCTCTGG - Intergenic
1048486021 8:134848165-134848187 CCCAGAGCCAAGCATGGCACTGG + Intergenic
1049404005 8:142443555-142443577 CCCAGGCCCGCCCCCGGCTCTGG - Intergenic
1049557533 8:143290566-143290588 GCCAGACGCGCCCCTGGAACTGG - Intronic
1049995936 9:1033681-1033703 CCCAGGCCAGCCCAGGGCAGTGG - Intergenic
1053363796 9:37508663-37508685 CCCAGACCTACCCAGGCCACTGG + Intergenic
1062550918 9:137086236-137086258 CCCCGACCCGCCTATGGCGCGGG + Intergenic
1062558923 9:137130373-137130395 CCCCGACCCGCCTATGGCGCGGG - Intergenic
1062648804 9:137564996-137565018 CACAGACCCACCCAGGGAACGGG + Intronic
1186193847 X:7092725-7092747 CTCAAACCTGCCCATGACACTGG + Intronic
1190784007 X:53625887-53625909 CCCAGTCCCGGCCCCGGCACCGG - Intronic
1198243530 X:134807586-134807608 CCTCGACCCGGACATGGCACAGG + Exonic