ID: 1094495063

View in Genome Browser
Species Human (GRCh38)
Location 12:30984081-30984103
Sequence TGCAGGGGCCCTTGCCGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094495063_1094495073 28 Left 1094495063 12:30984081-30984103 CCTCAGCGGCAAGGGCCCCTGCA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1094495073 12:30984132-30984154 CGCTCAGCAGGAGCTGAGTGTGG 0: 1
1: 0
2: 8
3: 44
4: 346
1094495063_1094495070 16 Left 1094495063 12:30984081-30984103 CCTCAGCGGCAAGGGCCCCTGCA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1094495070 12:30984120-30984142 CACGCCTGCTTCCGCTCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1094495063_1094495074 29 Left 1094495063 12:30984081-30984103 CCTCAGCGGCAAGGGCCCCTGCA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1094495074 12:30984133-30984155 GCTCAGCAGGAGCTGAGTGTGGG 0: 1
1: 1
2: 5
3: 198
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094495063 Original CRISPR TGCAGGGGCCCTTGCCGCTG AGG (reversed) Intronic
900417060 1:2540173-2540195 AGCAAGGGCCCTTCCCCCTGAGG - Intergenic
900515914 1:3082198-3082220 TGCAGAGGGCCTGGCCGCGGGGG - Intronic
901402483 1:9024563-9024585 AGAAGGGGCCCTTGCAGGTGTGG - Intronic
902369108 1:15994228-15994250 TGCAGGGGACCCTGGCACTGCGG + Intergenic
902515260 1:16986541-16986563 TGCAGGGGCCGCTGGCGCTGAGG - Exonic
903029455 1:20452384-20452406 TGCAGAGGCCCCAGCTGCTGAGG + Intergenic
903070108 1:20722861-20722883 TGCTGGGGGCCTTCCTGCTGTGG - Exonic
903342127 1:22661089-22661111 TGCAGGTGAACTTGCCACTGCGG - Exonic
904677122 1:32205478-32205500 TGGAGTGCCCCTTGCGGCTGTGG + Intergenic
908818444 1:68057752-68057774 AGCAGGGGCCCCTGCTGGTGAGG - Intergenic
912420105 1:109536895-109536917 TGGCAGGGCCCTTGCTGCTGAGG - Intergenic
912498860 1:110108634-110108656 GGCAGGGGCCCTTGTGACTGGGG - Intergenic
912529883 1:110312620-110312642 TGGAGAGGCCCTTGCCGGAGAGG + Intergenic
912757586 1:112337216-112337238 TGGAGGGGCCCTCGGCACTGGGG - Intergenic
915547469 1:156609229-156609251 TGCAGGGGCCCTCAGCACTGGGG + Intergenic
922978317 1:229803375-229803397 TGCCAGTGCCCTTGCAGCTGTGG + Intergenic
924707010 1:246509887-246509909 TGCAGGTGCCCATGCTGCTGTGG + Intergenic
924948628 1:248863148-248863170 TGCAGGGGTGCTTGACGCGGCGG + Intergenic
1062843200 10:686765-686787 TGCAGGGGCACTTCCTGCTGCGG - Intronic
1065552600 10:26884184-26884206 TGCAGAGGCACATGCAGCTGAGG + Intergenic
1065600452 10:27362727-27362749 TGCAGAGGCACATGCAGCTGAGG - Intergenic
1069573118 10:69506580-69506602 GGGAGGGGCCCTTGCTGATGGGG + Intronic
1069748748 10:70732492-70732514 TGCAGGAGGCCATGCCGCAGTGG - Intronic
1071702228 10:87951826-87951848 TGCAGTGGCCTTTGCCTATGGGG + Intronic
1072808681 10:98443505-98443527 GGCTGGGGCCCTTTCCTCTGTGG + Intronic
1073045031 10:100632034-100632056 TACAGGGGCCCTTGCTGGAGGGG - Intergenic
1075077244 10:119359596-119359618 TGCTGTGGCCCTGGCTGCTGTGG + Intronic
1077206424 11:1346783-1346805 AGGAGGGGCCCATGCCGCTGGGG + Intergenic
1077231599 11:1460266-1460288 GGCAGGGGCCCTGTACGCTGGGG - Intronic
1077351822 11:2096669-2096691 CGCAGAGGCCCTTGCAGCTGGGG + Intergenic
1077888953 11:6405193-6405215 TGCAGGGCCCCAGGCAGCTGGGG - Intronic
1081975144 11:47229141-47229163 TGCTGGGGCCCCTGAAGCTGAGG + Intronic
1082787435 11:57324679-57324701 TGCAGGGGCCGAGGGCGCTGGGG - Intronic
1083742869 11:64720437-64720459 TGTAGGGGCCCTTGTGCCTGAGG + Intronic
1083774474 11:64887816-64887838 TGGTGGGGCTCTTCCCGCTGTGG - Intronic
1083899011 11:65634738-65634760 TGCAGTGGCCCTTCCTGTTGGGG + Intronic
1088522356 11:110712779-110712801 TGCAGGGGCGCCTTCCGCCGCGG - Intronic
1089304175 11:117516435-117516457 GGCAGGGGCCCTGGCTGGTGAGG + Intronic
1089809007 11:121116080-121116102 TGCCTGGACCCTTGCCTCTGTGG + Intronic
1089813724 11:121153311-121153333 TGCTGGAGACCTTGCCACTGTGG - Intronic
1089995194 11:122900033-122900055 TGCAGGGTCACCTGCCTCTGGGG - Intronic
1092259747 12:6946479-6946501 TGCAGGGAAGCTGGCCGCTGTGG + Intronic
1093653502 12:21670873-21670895 TGCAGGGGAGCTTGCATCTGTGG - Intronic
1094495063 12:30984081-30984103 TGCAGGGGCCCTTGCCGCTGAGG - Intronic
1096072407 12:48782630-48782652 TGGAGAGGCCCAGGCCGCTGAGG + Exonic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1101610262 12:106284787-106284809 TGCAGGTGGCCTTGTCCCTGTGG - Intronic
1103915524 12:124373771-124373793 TGCAGGGGCCCTGGGCACGGTGG + Intronic
1103915535 12:124373816-124373838 TGCAGGGGCCCTGGGCACGGTGG + Intronic
1104698057 12:130879611-130879633 TCCAGGGGCGCTTCCCCCTGAGG - Intergenic
1104928961 12:132328490-132328512 TGCAGTGTCCTTTGCCCCTGAGG - Intronic
1107731041 13:43349289-43349311 TGCAGAGGGCCTTGCTTCTGTGG - Intronic
1113494845 13:110718982-110719004 TGGAGCGGCTCCTGCCGCTGTGG + Intronic
1113831178 13:113297055-113297077 TCCAGGGTCACGTGCCGCTGCGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1117353437 14:54902386-54902408 TTGAGCAGCCCTTGCCGCTGGGG + Exonic
1118809221 14:69261230-69261252 TGCGGGGGCCCTTGGCGCTCTGG + Intronic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1122771977 14:104101609-104101631 TGCTGGGGCCCTTGGAGCAGAGG + Intronic
1128739452 15:70073595-70073617 TACAGGGGCACTTGCCCCAGAGG - Intronic
1130273940 15:82466800-82466822 TGCAGGGCCCCATGCCGGGGTGG - Intergenic
1130466288 15:84194174-84194196 TGCAGGGCCCCATGCCGGGGTGG - Intergenic
1130497976 15:84479362-84479384 TGCAGGGCCCCATGCCGGGGTGG + Intergenic
1130588582 15:85198767-85198789 TGCAGGGCCCCATGCCGGGGTGG - Intergenic
1133001832 16:2855797-2855819 TGCTGGGGGCCTGGCAGCTGGGG - Exonic
1133006241 16:2883290-2883312 GGCTGGGGCCCTTGGCGCGGAGG + Exonic
1136470874 16:30479170-30479192 TGCAGGGTCCCATGCTGCAGGGG + Exonic
1137244392 16:46690234-46690256 AGCAGGCGCCGTTCCCGCTGAGG + Intronic
1138504600 16:57471771-57471793 GGGAGGGGCCCTTGCTCCTGCGG - Exonic
1139429806 16:66905061-66905083 GTCAGGGTCCCATGCCGCTGAGG + Intergenic
1142224414 16:88870597-88870619 TGCAGGGACCCTCGTGGCTGGGG + Intergenic
1142289299 16:89185454-89185476 TGCAGTGGCCCTGGCTCCTGAGG + Intronic
1143187480 17:5019373-5019395 AGCAGTGGCCATTGCCGCAGAGG - Intronic
1144685567 17:17223879-17223901 TGCAGGGCCCCCTGCCGCCCCGG + Intronic
1144960004 17:19039582-19039604 GGCTGGGTCACTTGCCGCTGTGG + Intronic
1144975156 17:19134942-19134964 GGCTGGGTCACTTGCCGCTGTGG - Intronic
1146724682 17:35147730-35147752 TCCAGGGGCACCTGCCCCTGTGG + Intergenic
1148209470 17:45799615-45799637 GGCTGGGGCCCTTGCCTCTGGGG + Intronic
1148744412 17:49910407-49910429 TACAGGGGCGCTCGGCGCTGCGG + Intergenic
1156181738 18:34612503-34612525 TGCCAGGGCCCCTTCCGCTGAGG - Intronic
1158661604 18:59393559-59393581 TGCACTGGCGCTTGCCGTTGAGG - Intergenic
1160583767 18:79901683-79901705 TGCAGGGGCCGTGGCAGGTGGGG - Intergenic
1160781040 19:878092-878114 TGCTGGGGCACGTGGCGCTGGGG - Intronic
1160781083 19:878248-878270 TGCTGGGGCCCGTGGGGCTGGGG - Intronic
1161055425 19:2188506-2188528 TGCAGGCCCCCTCGGCGCTGGGG + Intronic
1161389334 19:4013118-4013140 TCCAGGGGCCGGTGCGGCTGTGG - Exonic
1161505098 19:4639547-4639569 GGCCGGGGCCGTTGCCGCGGCGG - Intronic
1165293109 19:34905019-34905041 TGCGCCGGCCCTTGCAGCTGGGG - Intergenic
1167158314 19:47752506-47752528 TGCAGGCGTGCTGGCCGCTGTGG - Exonic
1167497935 19:49830258-49830280 TGCTGGAGCCCTGGCCCCTGGGG + Intronic
1167733379 19:51275746-51275768 TGCAGGGGGCTCTGCAGCTGAGG - Intergenic
924978083 2:196121-196143 TGGAGGGGCCCGTGGCGCAGTGG + Intergenic
925993006 2:9268991-9269013 TGCAGGGGCCGCTGGTGCTGTGG + Intronic
926058272 2:9789446-9789468 TGCGGGGCCCCTTGTTGCTGAGG - Intergenic
928285852 2:29989472-29989494 TGCAGGGGCATCTGCCTCTGGGG + Intergenic
929603276 2:43218193-43218215 TGCAGGGGGCCAGGCGGCTGTGG - Intergenic
930029862 2:47051827-47051849 AGCAGGGCCCCATGCAGCTGTGG + Exonic
932407691 2:71524718-71524740 TGCAGAGGCCCTTGCACATGGGG - Intronic
934179796 2:89610644-89610666 TGCATGGTCCCTTTCCGCAGTGG - Intergenic
937815339 2:126244631-126244653 TGCAGGGGGCCGTGGCTCTGGGG - Intergenic
939076276 2:137606397-137606419 TGCAGGGCCCCTTTCCTCTCAGG - Intronic
941670045 2:168283452-168283474 TGCAGGTGCCCTTGGCTGTGCGG - Intergenic
942481391 2:176392302-176392324 TCAAGGGGCCCTTGGTGCTGAGG + Intergenic
946559949 2:220901507-220901529 GGCTGGGGTCCTTGCCGATGTGG - Intergenic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
948487363 2:238289226-238289248 TCCCGCGGCCCTGGCCGCTGGGG - Intronic
948632205 2:239309602-239309624 TGCAGGAGCCCCTGCCAGTGAGG + Intronic
1170736044 20:19015028-19015050 TGTAGGGGCCCTTGACTTTGAGG - Intergenic
1170941191 20:20849224-20849246 TGCTGGGGCCCATGCAGCAGGGG + Intergenic
1171459865 20:25292336-25292358 TGCAGTGAGCCTTGCGGCTGAGG + Intronic
1174390921 20:50217835-50217857 AGCACGGGCACTTGCAGCTGAGG - Intergenic
1178329131 21:31671970-31671992 TGCTGGGGCGCCTGCGGCTGTGG + Exonic
1179417713 21:41211616-41211638 TGCAGAGGCCACTGCTGCTGTGG + Intronic
1179992044 21:44953250-44953272 TTCAGGGGCCCTGGGCACTGTGG + Intronic
1180095193 21:45553136-45553158 GGCAGGGGCCTTTGCTGCCGTGG + Intergenic
1181475802 22:23167159-23167181 TGCAGGTGCCCTCACCCCTGGGG + Intergenic
1181694396 22:24585673-24585695 TGCTGGGGCCCCTCCCACTGAGG + Exonic
1182058318 22:27378661-27378683 GGCAGGGCCCCTTCCCTCTGCGG + Intergenic
1183786116 22:40030100-40030122 TGCAGGGGCACTGGCTGCAGTGG + Exonic
1184339953 22:43880694-43880716 GGCAGGGCCTCTTCCCGCTGGGG + Exonic
1185095977 22:48806320-48806342 TGAAGGGGCCCCTGGGGCTGGGG + Intronic
1185371214 22:50461770-50461792 TGCGGGGGCCGTTGGGGCTGCGG - Intronic
952233173 3:31453204-31453226 TGAAGGGGACCTTCTCGCTGGGG - Intergenic
954412812 3:50378387-50378409 TGCAGAGGGCCCTGCCCCTGGGG + Intronic
954540426 3:51390145-51390167 TGTAGGAGGCCTTGCTGCTGTGG + Intergenic
955201520 3:56856048-56856070 AGCAGGGGGCCCTGCCGCAGAGG + Intronic
957386480 3:79502502-79502524 TGCAGGAGCCCATGGCGGTGGGG - Intronic
961752893 3:129107729-129107751 TGCCTGGGCCCTTGCAGCGGAGG - Intronic
961822502 3:129582329-129582351 TGCAGAGGCTCTGGGCGCTGGGG + Intronic
967946902 3:194811254-194811276 TGCAGGAGCCTGTGCTGCTGGGG + Intergenic
969863231 4:10054009-10054031 TACAGGGGCCCTGGCTGATGTGG - Intronic
970741889 4:19249453-19249475 TGCAGGGCCACATGCCTCTGTGG + Intergenic
972672512 4:41227163-41227185 TGCAGGGCCCCTTTCCACAGTGG + Intergenic
973041769 4:45477430-45477452 TGCAGGAGCCCATGGCGATGGGG + Intergenic
982436288 4:155385196-155385218 TGCAGGGGACCCTGGCACTGTGG + Intergenic
984588066 4:181585921-181585943 TGCAGGTCCCCTAGCCTCTGTGG - Intergenic
984632746 4:182077857-182077879 TGCAGTGGCCCGTCCCACTGTGG + Intergenic
992315251 5:75546057-75546079 GGCAGGGTCCCTAGCCCCTGTGG - Intronic
996790749 5:127290690-127290712 TGCCGGGGCAGTGGCCGCTGGGG - Intergenic
998517467 5:142769624-142769646 TGCAGGGGCACTTGCCCTCGTGG + Intergenic
999120684 5:149207154-149207176 TGCAGAGGCCCAGGCAGCTGGGG - Intronic
1001951760 5:175821191-175821213 TTCAGTTGCCCTTGCCCCTGGGG - Intronic
1002645001 5:180648762-180648784 TGCAGGGGACCCTCCCGCGGGGG + Intronic
1003624137 6:7727223-7727245 TGCAGGGGCCGGGGCCGGTGCGG - Exonic
1004217620 6:13717032-13717054 TGCAGGAGCCCATGGCGGTGGGG - Intergenic
1006897619 6:37480945-37480967 TGCTGGGGCCCCTGCTGCTGTGG - Exonic
1007359897 6:41347369-41347391 TTCATGGGCCCTTGCTGCAGAGG - Intronic
1007790335 6:44304908-44304930 GGCAGGGGCACTTCCAGCTGGGG + Intronic
1009272276 6:61628447-61628469 TGCAGGTTCCCCTGCAGCTGCGG - Intergenic
1010727947 6:79356408-79356430 TGAAGGGGCCCTTGCTGTTGAGG + Intergenic
1016845499 6:148564643-148564665 TCCAAGGGCCCTTTCAGCTGTGG + Intergenic
1017077652 6:150633586-150633608 TGCAGGGGCCTCTGACGATGGGG + Intronic
1017237309 6:152130082-152130104 GGCAGGGGCACTGGCTGCTGCGG + Intronic
1017830096 6:158118977-158118999 TGCTGGGGCCCTGGTTGCTGGGG - Intronic
1017872875 6:158501992-158502014 TGCATGGGCCCCTGCGGCGGGGG - Exonic
1018981870 6:168607487-168607509 GGCAGGTGCCCTGGCTGCTGCGG - Intronic
1019042492 6:169118577-169118599 TACAGGGTCCCTGGCCCCTGAGG - Intergenic
1020032111 7:4940503-4940525 TGCGTGGTCCCTTGCCTCTGTGG - Intronic
1022107222 7:27205204-27205226 TGCAGGGGCCCGTGCCACCCAGG + Intergenic
1023715455 7:43039411-43039433 TGCAGGGGCCCTTTCCCATGCGG + Intergenic
1024578278 7:50782310-50782332 TGCAGAGGCCCCGGCCGCGGCGG - Intronic
1029413627 7:100430189-100430211 TGCGGGGTCCCCAGCCGCTGCGG + Exonic
1029749745 7:102536463-102536485 TGGAGGGGCCCTGCCCTCTGGGG - Intergenic
1029767695 7:102635568-102635590 TGGAGGGGCCCTGCCCTCTGGGG - Intronic
1035013298 7:155740003-155740025 TGCCGGAGCCCCTGGCGCTGGGG - Exonic
1035171213 7:157018332-157018354 TGGAGGGGCGCTTGCCGCGCCGG + Intergenic
1035735298 8:1883015-1883037 TGCAGGGGCCTCTGTCACTGTGG + Intronic
1037419418 8:18686630-18686652 TCCAGGGGCCCTTGATGCTCAGG + Intronic
1037744269 8:21630530-21630552 TGCAGGGGCCTTGTCAGCTGGGG - Intergenic
1037807457 8:22066605-22066627 AGCCGGGCCCCTTGCGGCTGAGG - Intronic
1039455021 8:37700374-37700396 TGCCGGAGCCCTTGGTGCTGGGG - Intergenic
1039902357 8:41762126-41762148 AGAAGGGGCTCCTGCCGCTGTGG - Intronic
1042751512 8:72162863-72162885 AGCTGGGGCCCTTGCAGTTGGGG - Intergenic
1049192452 8:141295896-141295918 TGCTGGAGCCCTTGCCCCTCTGG + Intronic
1049255447 8:141611290-141611312 TCCAGGGGCCGTTGGCTCTGGGG + Intergenic
1049317180 8:141975540-141975562 TGTAGGGCTCCTTGCCCCTGAGG + Intergenic
1049494071 8:142921559-142921581 CGCAGGGGCCCTTCCCTGTGAGG + Intergenic
1053443261 9:38132742-38132764 GGCAGGGGCCCTGGCAGCTCTGG + Intergenic
1056186816 9:84143286-84143308 TGCAGCAGCCCCTGCCCCTGGGG + Intergenic
1056658383 9:88527095-88527117 TGCAGGGCCCTGTGCCTCTGAGG - Intergenic
1056659115 9:88531980-88532002 TGCAGGGCCCTGTGCCTCTGAGG + Intergenic
1060934903 9:127509133-127509155 TGCAGGGGCCGGGGCCGCGGGGG + Intronic
1061123156 9:128656611-128656633 TGCAGCGGCCCTGGCCGCCCCGG + Exonic
1061178402 9:129010598-129010620 TGCAGGCACACTTGCTGCTGTGG - Intronic
1061714566 9:132510556-132510578 TGCGGGGTCCCTTGCCACAGTGG - Intronic
1062267627 9:135694611-135694633 TGCAGAGGCCACAGCCGCTGAGG + Intronic
1062428009 9:136514905-136514927 TGCAGTAGCCCCTGCCCCTGGGG - Intronic
1188448070 X:30278053-30278075 ATCAAGGGCCCTTGCCCCTGTGG + Intergenic
1190063811 X:47226917-47226939 GGCATGGGCCCTAGGCGCTGTGG + Intronic
1196741289 X:119028431-119028453 TTCAGTGGCCCTCGCCGCCGCGG + Intergenic
1200229778 X:154438036-154438058 AGCAGGAGCCCCTGCCGCTGAGG - Intronic