ID: 1094500670

View in Genome Browser
Species Human (GRCh38)
Location 12:31018265-31018287
Sequence CCCAGCTGGCCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094500670_1094500678 -3 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500678 12:31018285-31018307 GGGCTGAGTGGGCCTAGGGAAGG No data
1094500670_1094500683 13 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500683 12:31018301-31018323 GGGAAGGAGGACTGCAGGGTTGG No data
1094500670_1094500677 -7 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500677 12:31018281-31018303 AGCTGGGCTGAGTGGGCCTAGGG No data
1094500670_1094500680 8 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500680 12:31018296-31018318 GCCTAGGGAAGGAGGACTGCAGG No data
1094500670_1094500676 -8 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500676 12:31018280-31018302 CAGCTGGGCTGAGTGGGCCTAGG No data
1094500670_1094500679 0 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500679 12:31018288-31018310 CTGAGTGGGCCTAGGGAAGGAGG No data
1094500670_1094500684 20 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500684 12:31018308-31018330 AGGACTGCAGGGTTGGTCCCAGG No data
1094500670_1094500682 9 Left 1094500670 12:31018265-31018287 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1094500682 12:31018297-31018319 CCTAGGGAAGGAGGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094500670 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr