ID: 1094501555

View in Genome Browser
Species Human (GRCh38)
Location 12:31025735-31025757
Sequence ATGTATTTACGTGGTTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094501555_1094501560 13 Left 1094501555 12:31025735-31025757 CCTTTGAAACCACGTAAATACAT No data
Right 1094501560 12:31025771-31025793 CCTACTCCTCAATGAACATTGGG No data
1094501555_1094501558 12 Left 1094501555 12:31025735-31025757 CCTTTGAAACCACGTAAATACAT No data
Right 1094501558 12:31025770-31025792 ACCTACTCCTCAATGAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094501555 Original CRISPR ATGTATTTACGTGGTTTCAA AGG (reversed) Intergenic
No off target data available for this crispr